Indian Journal of Cancer
Home  ICS  Feedback Subscribe Top cited articles Login 
Users Online :546
Small font sizeDefault font sizeIncrease font size
Navigate here
  Search
 
 » Next article
 » Previous article 
 » Table of Contents
  
Resource links
 »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
 »  Article in PDF (191 KB)
 »  Citation Manager
 »  Access Statistics
 »  Reader Comments
 »  Email Alert *
 »  Add to My List *
* Registration required (free)  

 
  In this article
 »  Abstract
 »  Materials and Me...
 »  Results
 »  Discussion
 »  Conclusion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed7227    
    Printed175    
    Emailed0    
    PDF Downloaded552    
    Comments [Add]    
    Cited by others 16    

Recommend this journal

 


 
ORIGINAL ARTICLE
Year : 2006  |  Volume : 43  |  Issue : 4  |  Page : 163-168
 

Expression of cyclooxygenase-2 and 12-lipoxygenase in human breast cancer and their relationship with HER-2/neu and hormonal receptors: Impact on prognosis and therapy


1 Biochemistry and Molecular Biology Unit, Departments of Cancer Biology, NCI, Cairo University, Egypt
2 Biochemistry and Molecular Biology Unit, Departments of Oncology, NCI, Cairo University, Egypt
3 Biochemistry and Molecular Biology Unit, Departments of Surgical Pathology, NCI, Cairo University, Egypt

Correspondence Address:
A M Mohammad
Biochemistry and Molecular Biology Unit, Departments of Cancer Biology, NCI, Cairo University
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0019-509X.29421

Rights and Permissions

 » Abstract 

Background: A number of studies have shown over-expression of cox-2 in breast cancer. Also it has been recorded that human breast cancer expresses high level of cox-2 and 12-lipoxygenase which may be beneficial in future therapy plan for those patients. Aims:The present study aims to examine the level of transcripts of cox-2 and 12-lipoxygenase in Egyptian breast cancer patients and to compare between the expressions of both enzymes and TNM staging, hormone receptors status (including estrogen and progesterone) and HER2/neu expression. Materials and Methods:Total cellular RNA was extracted from 64 frozen tissue samples of breast carcinoma and their corresponding normal adjacent tissues. Cox-2 and 12-lipooxygenase expressions were detected using RT-PCR. Hormonal receptors as well as HER2/neu were detected immuno-histochemically for each patient. Results: About 47 and 62.5% of carcinoma samples showed over-expression of cox-2 and 12-lipooxygenase respectively as compared to their corresponding normal tissues. The results revealed that cox-2 significantly associated with TNM staging ( P =0.0047) and hormonal receptors status ( P = 0.0201). The relationship between cox-2 and HER2/neu expression was close to a significant value ( P =0.0747). 12-lipooxygenase showed only significant association with TNM staging ( P =0.0076). Neither hormonal receptors nor HER2/neu showed significant association with this enzyme. Conclusion: Elevated levels of cox-2 and 12-lipoxygenase expression were detected in human breast cancer. Also, the results revealed that cox-2 and 12-lipooxygenase mRNA expressions are associated with TNM staging in human breast cancer. Furthermore, there is an inverse association between cox-2 expression and hormonal receptor status. This observation may drive us to the possible role of those two enzymes in determining the plan of therapy of breast cancer patients.


Keywords: Breast cancer, cox-2; estrogen receptor, Her-2/neu, lipoxygenase-12, progesterone receptor


How to cite this article:
Mohammad A M, Abdel H A, Abdel W, Ahmed A M, Wael T, Eiman G. Expression of cyclooxygenase-2 and 12-lipoxygenase in human breast cancer and their relationship with HER-2/neu and hormonal receptors: Impact on prognosis and therapy. Indian J Cancer 2006;43:163-8

How to cite this URL:
Mohammad A M, Abdel H A, Abdel W, Ahmed A M, Wael T, Eiman G. Expression of cyclooxygenase-2 and 12-lipoxygenase in human breast cancer and their relationship with HER-2/neu and hormonal receptors: Impact on prognosis and therapy. Indian J Cancer [serial online] 2006 [cited 2019 May 21];43:163-8. Available from: http://www.indianjcancer.com/text.asp?2006/43/4/163/29421


Cyclooxygenase is a rate-limiting enzyme for prostaglandin (PG) synthesis from arachidonic acid. It incorporates two molecules of oxygen into arachidonic acid and produces PGG2 which is reduced by the same enzyme to PGH2.[1],[2],[3] Two isoforms of the same enzyme are known; cyclooxygenase-1, which is a constitute enzyme expressed in many tissue and cyclooxygenase-2, which is an inducible enzyme synthesized at inflammatory lesions by cytokines, growth factors and tumor promoters.[4],[5] In breast cancer, greater amounts of prostaglandins are produced in tumor tissues than normal tissue derived from the same organ.[6] Increased level of cyclooxygenase-2 in human breast cancer cell has been reported, denoting that breast cancer tumor cells have more cyclooxygenase-2 protein than normal adjacent cells.[7] Cyclooxygenase-2 is also involved in angiogenesis process,[8],[9] by way of regulating the vascular epithelial growth factor pathway and Peroisome proliferators-activated receptor (PPARg).[8],[10] However, the involvement of cox-1 and cox-2 in the progression and metastasis of breast cancer is not yet fully understood, although it was mentioned that over-expression of cox-2 in breast cancer cells increased metastatic potential.[11],[12],[13]

12-lipoxygenase has been fully cloned and shown to be of significant importance in cancer. Lipoxygenase pathways produce a wide range of eicosanoids including 12-hydroxyeicosatetraenoic acid (HETE), lipotoxins, leukotrins and hydroxylactadienoic acid. 12- lipoxygenase controls hepaxilin among which 12-HETE has been shown to be an eicosanoid that has profound stimulatory effect on cancer cells. 12-HETE, a metabolite of 12-lipoxygenase, has been reported to increase the invasion and migration of breast cancer cells, by mechanisms such as induction of collagenase secretion from the cells[14] and also through upregulation of the expression and secretion of cathepsin B.[15] 12- lipoxygenase and its metabolites have been shown to induce the growth of tumor in animal models and increase angiogenesis in breast cancer and prostate cancer.[16],[17]

The current study examined the level of the transcripts of cox-2 and 12-lipoxygenase in human breast cancer and examined the relationship between these two enzyme and clinical outcomes in those patients which may be important in the plan of therapy.


 » Materials and Methods Top


Patients

This study was performed on tissue samples from 64 women aged between 27-74 years (median 47.6 years) who were examined during 2000-2003 at the hospital of National Cancer Institute, Cairo University. Breast cancer tissues and their corresponding matched adjacent normal tissues were obtained immediately after surgery. Tissues were frozen in liquid nitrogen within one hour of surgical removal and subsequently stored at -80°C.

All tissues analyzed were obtained from patients who had provided informed consent and with Institutional Review Board approval in accordance with the NCI, Cairo University. All clinicopathological characteristics for the cases under investigation were collected from epidemiology and biostatistics department and are summarized as shown in [Table - 1].

Specimen preparation

Formalin-fixed, paraffin-embedded blocks were obtained from the primary breast tumors received for frozen section examined at the Department of Pathology of the National Cancer Institute, Cairo. A slide stained with hematoxylin and eosin was prepared from each block and used for pathological confirmation of breast cancer. For the same block, 4-micron tissue sections were prepared for immunohistochemical study. The two pathologists among the authors reviewed the slides according to the world health organization (WHO) classification of breast tumors. The histological grading system was employed according to the Bloom, Scarff and Richardson grading system.

Immunohistochemical analysis

Immunohistochemical reactions were performed using the following mouse monoclonal antibodies applied for one hour at room temperature (all from DakoCytomation, Denmark): Hercep Test kit for c-erbB-2 (HER2/neu), clone 1D5 for estrogen receptor (ER) and 1A6 for progesterone receptor (PgR) (optimally prediluted) The antigens were visualized using biotinylated antibodies, streptavidin-peroxidase complex (LSAB2, DakoCytomation) and 3,3'-diaminobenzedine (DAB) (DakoCytomation). Detection of HER2/neu, ER and PgR expression was preceded by 15-min exposure of the sections to boiling in antigen retrieval solution (Dako Cytomation) in a microwave oven. Appropriate positive controls were used. For negative controls, primary antibodies were omitted. Cases were considered positive for ER and PgR when they showed a nuclear staining in more than 5% of tumor cells. Evaluation of c-erbB-2 over-expression was done according to the manufacturer's instructions by scoring the percentage of stained invasive malignant cells and tissue was considered to be positive for c-erbB-2 expression if it had a score of 2+ or 3+ and as negative if it had a score of 0 or 1+.

RT-PCR

Total RNA from the tissues collected was extracted using high pure RNA tissue kit (Roche, Diagnostics GmbH, Germany) according to the manufacturer's instruction and RNA was dissolved in diethylpyrocarbonate (DEPC) water and stored at -70°C until assaying. Routine reverse transcriptase polymerase chain reaction (RT-PCR) was carried out using a PCR mix that was commercially available (Qiagen One-step RT-PCR kit, Germany). The primers used were: for cycloxygenase-2: 5' tgtatgagttgtggatttga 3' and 5' tggatggggtttcagaaata 3', for 12-lipoxygenase: 5' tcaactggagaaaagaacttca 3' and 5' gatcacgttggctggaat 3' and for b-actin: 5- acactgtgcccatctacgagg 3' and 5' aggggccggactcgtcatact 3'. Reactions were carried out at the following conditions: a reverse transcription reaction temperature of 50°C for 30 min. followed by initial PCR activation step at 95°C for 15 min. followed by 35 cycles consisted of 94°C for one min, 56°C for one min and 72°C for one min and final extension at 72°C for 10 min. PCR products were separated on a 2% agarose gel and the intensity of bands were measured using BioDocAnalyzer (BioMetra, Germany).

Statistical analysis

Statistical analysis was performed using statistical package for social sciences (SPSS) software for PC (version 10). Chi-square test was used to determine whether there was a statistically significant difference in the expression of cox-2 and 12-lipoxygenase between the cancer specimen and the corresponding adjacent normal specimen. Also, Chi-square test was used to analyze the statistical correlation between the over-expression of cox-2 and 12-lipoxygenase with various clinicopathological factors. P -value less than 0.05 was considered statistically significant.


 » Results Top


In this study cox-2 expression as well as 12-lipoxygenase were detected using reverse transcriptase polymerase chain reaction (RT-PCR) in 64 human breast carcinomas and their corresponding normal adjacent tissues. Bands obtained were analyzed using BioDocAnalyzer (Biometra, Germany). Cox-2 or 12-lipoxygenase were defined positive when their percent of intensity was greater by 5% than the control.[18] Hormonal receptors (including ER and PgR) and HER2/neu were detected immunohistochemically for each patient. By RT-PCR analysis, 30 of the 64 (46.9%) cancer specimens showed over-expression of cox-2 as compared to their corresponding normal adjacent tissues, [Figure - 1] shows representative samples for cox-2 over-expression of breast cancer tissues as compared to their normal tissues. The association of cox-2 and TNM stage was statistically analyzed. There was a steady significant increase of cox-2 expression with increased TNM staging scoring 20% in both 2A and 2B whereas it increased to 38.9% and 77.8% in 3A and 3B respectively ( P =0.0047).

The immunohistochemical analysis reveled that 63% of the patients exhibited positive hormonal receptors including ER and PgR. The correlation between cox-2 expression and the hormone receptor status revealed that 33.3% of the negative hormone receptor patients exhibited normal cox-2 expression, while 66.7% of the negative hormone receptor cases exhibited cox-2 over-expression. It also found that 65% of the positive hormone receptor patients has normal cox-2 expression while the rest (35%) showed cox-2 over-expression. This association was statistically significant ( P = 0.0201).

Forty one percent of the cases examined exhibited over-expression of HER2/neu, 61.5% of them showed over-expression of cox-2 while in HER2/neu negative cases (about 59% of all breast cases studied), cox-2 over-expression was detected in 36.8% of them. However, the statistical analysis is close to a significant relationship ( P =0.0747) between cox-2 expression and HER-2/neu patient's status. [Table - 2] summarizes these associations between cox-2 expression with TNM staging, HR and HER2/neu.

By RT-PCR analysis, 24 of the 64 (38%) cancer specimens showed over-expression of 12-lipoxygenase as compared to their corresponding normal adjacent tissues, [Figure - 1] shows over-expressions in cases 9 and 21 while it was normal in case 4 as compared to their normal tissues. The association of lipoxygenase-12 and TNM stage were statistically analyzed. There was a steady significant increase of lipoxygenase-12 expression as in cox-2 with increased TNM staging where it scored 20% in both 2A and 2B and increased to 66.7% and 77.8% in 3A and 3B respectively. This association was statistically significant ( P =0.0076).

The relation between lipoxygenase-12 expression and the hormone receptors status revealed that 33.3% of the negative hormone receptor patients exhibited normal lipoxygenase-12 expression, while 66.7% of the negative HR cases exhibited lipoxygenase-12 over-expression. It was also found that 40% of the positive HR patients has normal lipoxygenase-12 expression while the rest (60%) showed lipoxygenase-12 over-expression. This association was statistically non-significant ( P =0.7908). Forty one percent of the cases examined exhibited over-expression of HER2/neu, 61.5% of them showed over-expression of lipoxygenase-12 while in HER2/neu negative cases (about 37.5% of all breast cases studied), lipoxygenase-12 over-expression was detected in 63.2% of them. However, the statistical analysis revealed no significant relationship ( P =1.0) between lipoxygenase-12 expression and HER-2/neu patient's status. [Table - 3] summarizes these associations.

The relationship between both enzymes studied was also analyzed. From 24 patients that normally expressed 12-lipoxygenase, only 10 of them showed over-expression of cox-2, while 20 patients out of 40 that showed over-expression of 12-lipoxygenase expressed high level of cox-2. The statistical analysis showed no significant correlation between both enzymes ( P = 0.726).


 » Discussion Top


Elevated cox-2 expression in breast carcinoma was associated with large tumor size, high histological grade, negative hormone receptors status, high proliferation rate, high p53 expression and the presence of HER-2 oncogene amplification.[19] Jiang and his colleagues[20] showed that human breast cancer aberrantly expresses high levels of cox-2 and 12-lipoxygenase that may have prognostic value in patients with breast cancer.

Our study on 64 samples from breast carcinoma patients confirms previous reports. In our series, cox-2 was positively expressed in 47% of the 64 studied cases with negative detectable cox-2 expression in normal mammary gland epithelium surrounding malignant tissue. This observation is in keeping with recent data showing frequently higher cox-2 expression in various epithelial neoplasia compared with adjacent normal tissue.[21],[22],[23],[24] Also the expression of cox-2 was correlated with other tumor variables such as TNM staging, HR and HER-2/neu status. It was observed that there was a steady significant increase of cox-2 expression with increased TNM staging. A significant inverse association between over-expression of cox-2 and hormone receptor was detected, however the study found a close to significant correlation between the expression of cox-2 and HER-2/neu, in spite of an increase of the cox-2 expression among the patients with positive Her-2/neu expression. Also an increase of the cox-2 expression in the patients showing positive HER2/neu was noticed. These findings are supported by results reported by Ristimaki et al[22] and Sucic et al[25] indicating that elevated cox-2 expression is more common in breast cancer with poor prognostic characteristics and is associated with an unfavorable clinical outcome. Subbaramaiah and colleagues[26] showed that a high level of cox-2 protein was detected in 14 of 15 breast cancer samples that were positive for Her2/neu expression. In contrast, the level and frequency of cox-2 expression were significantly lower in HER2/neu negative samples, as only four of 14 of these samples were positive for cox-2. The mechanism by which cox-2 is up-regulated in breast cancer is unknown, but one possibility is that cancer cells become intrinsically more active in expressing cox-2 than do the non-neoplastic cells. To this end, both inactivation of tumor suppressor genes, such as p53 and activation of oncogenes, such as HER2/neu, have been implicated in induction of cox-2 expression.[27] Our results support this hypothesis, because elevated cox-2 expression was more common in samples with amplification of HER2/neu. However, because elevated cox-2 expression was not restricted to HER2/neu positive tumors, several other factors (such as activated Ras, over-expressed Src or epidermal growth factor receptor pathway) are likely to be responsible for elevated cox-2 expression as well.[27] Howe et al[28] derived a genetic evidence that cox-2 contributes to HER2/neu induced mammary tumorigenesis.

Several studies have suggested that fatty acids and other enzymatically oxidized lipids may play significant role in the development and progression of breast cancer. However, few studies have examined the molecular regulation of the enzymes involved in the biosynthesis of fatty acid derived metabolites in breast cancer cells and tissues.[29] 12-HETE (Eicosanoid product derived from archidonic acid through 12-lipoxygenase pathway) has been shown to increase growth, proliferation and metastatic potential.[30]

In the present study, we have shown that 12-lipoxygenase expression was up-regulated to some extent (38%) in breast cancer tissues, compared with their normal counterparts. These results are in agreement with Jiang et al[20] who reported increased levels of 12-lipoxygenase in breast cancer as compared with control tissues. The increase of 12-lipoxyenase expression in breast cancer tissues would be expected to result in increase of 12-HETE production and to increase metastatic potential which would be reflected in the clinical outcome of patients (not significantly apparent in this study). Our data revealed significant correlation between levels of 12-lipooxygenase and TNM staging, however it was insignificant with both hormone receptors and HER-2/neu. We have also analyzed the relationship between cox-2 and 12-lipoxygenase expression. Unfortunately, no significant correlation existed between the two enzymes.


 » Conclusion Top


Our findings are in accordance with the results of others in that they indicated elevated cox-2 and 12-lipooxygenase expression in breast carcinoma. Also, the results revealed that cox-2 and 12-lipooxygenase mRNA expressions are associated with TNM staging in human breast cancer. Furthermore, an inverse association between cox-2 expression and hormonal receptor status was detected. This observation may drive us to the possible role of those two enzymes in determining the plan of therapy for breast cancer patients.

 
 » References Top

1.Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenase)-1 and -2. J Biol Chem 1996;271:33157-60.   Back to cited text no. 1    
2.Williams CS, DuBois RN. Prostaglandin endoperoxide synthase: Why two isofoms? Am J Physiol 1996;270:G393-400.  Back to cited text no. 2  [PUBMED]  [FULLTEXT]
3.Herschman HR. Prostaglandin synthase 2. Biochem Biophys Acta 1996;1299:125-40.  Back to cited text no. 3  [PUBMED]  
4.Wu KK. Cyclooxygenase 2 induction: Molecular mechanism and pathophysiologic roles. J Lab Clin Med 1996;128:242-5.   Back to cited text no. 4  [PUBMED]  [FULLTEXT]
5.O'Neill GP, Ford-Hutchinson AW. Expression of mRNA for cyclooxygenase-1 and cyclooxygenase-2 in human tissues. FEBS Lett 1993;330:156-60.  Back to cited text no. 5    
6.Bennett A, Charlier EM, McDonald AM, Simpson JS, Stamford IF, Zebro T. Postaglandins and breast cancer. Lancet 1977;2:624-6.  Back to cited text no. 6    
7.Parrett ML, Harris RE, Joarder FS, Ross MS, Clausen KP, Robertson FM. Cyclooxygenase-2 gene expression in human breast cancer. Int J Oncol 1997;10:503-7.  Back to cited text no. 7    
8.Subbaramaiah K, Dannenberg AJ. Resveratrol inhibits the expression of cyclooxygenase-2 in mammary epithelialcells. Adv Exp Med Biol 2001;492:147-57.  Back to cited text no. 8    
9.Davies G, Salter J, Hills M, Martin LA, Sacks N, Dowsett M. Correlation between cyclooxygenase-2 expression and angiogenesis in human breast cancer. Clin Cancer Res 2003;9:2651-6.   Back to cited text no. 9    
10.Liang YC, Tsai SH, Tsai DC, Lin-Shiau SY, Lin JK. Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-gamma by flavonoids in mouse macrophages. FEBS Lett 2001;496:12-8.  Back to cited text no. 10    
11.Singh B, Berry JA, Shoher A, Ramakrishnan V, Lucci A. COX-2 overexpression increases motility and invasion of breast cancer cells. Int J Oncol 2005;26:1393-9.  Back to cited text no. 11    
12.Tsujii M, Kawano S, DuBois RN. Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc Natl Acad Sci 1997;94:3336-40.   Back to cited text no. 12    
13.Larkins TL, Nowell M, Singh S, Sanford GL. Inhibition of cyclooxygenase-2 decreases breast cancer cell motility, invasion and matrix metalloproteinase expression. BMC Cancer 2006;6:181.  Back to cited text no. 13    
14.Liu XH, Connolly JM, Rose DP. Eicosanoids as mediators of linoleic acid-stimulated invasion and type IV collagenase production by a metastatic human breast cancer cell line. Clin Exp Metast 1996;14:145-52.  Back to cited text no. 14    
15.Honn KV, Timar J, Rozhin J, Bazaz R, Sameni M, Ziegler G, et al . A lipoxygenase metabolite, 12-(s)-HETE, stimulates protein-kinase C-mediated release of cathepsin-B from malignant-cells. Exp Cell Res 1994;214:120-30.  Back to cited text no. 15    
16.Connolly JM, Rose DP. Enhanced angiogenesis and growth of 12-lipoxygenase gene-transfected MCF-7 human breast cancer cells in athymic nude mice. Cancer Lett 1998;132:107-12.  Back to cited text no. 16    
17.Nie D, Hillman GG, Geddes T, Tang K, Pierson C, Grignon DJ, et al . Platelet-type 12-lipoxygenase in a human prostate carcinoma stimulates angiogenesis and tumor growth. Cancer Res 1998;58:4047-51.  Back to cited text no. 17    
18.Sweeney CJ, Marshall MS, Barnard DS, Heilman DK, Billings SD, Cheng L, et al . Cyclo-oxygenase-2 expression in primary cancers of the lung and bladder compared to normal adjacent tissue. Cancer Detect Prev 2002;26:238-44.  Back to cited text no. 18    
19.Singh B, Lucci A. Role of cyclooxygenase-2 in breast cancer. J Surg Res 2002;108:173-9.  Back to cited text no. 19    
20.Jiang WG, Douglas-Jones A, Mansel RE. Levels of expression of lipoxygenases and cyclooxygenase-2 in human breast cancer. Prostaglandins Leukot. Essent Fatty Acids 2003;69:275-81.  Back to cited text no. 20    
21.Soslow RA, Dannenberg AJ, Rush D, Woerner BM, Khan KN, Masferrer J, et al . COX-2 is expressed in human pulmonary, colonic and mammary tumors. Cancer 2000;89:2637-45.  Back to cited text no. 21    
22.Ristimaki A, Sivula A, Lundin J, Lundin M, Salminen T, Haglund C, et al . Prognostic significance of elevated cyclooxygenase-2 expression in breast cancer. Cancer Res 2002;62:632-5.   Back to cited text no. 22    
23.Spizzo G, Gastl G, Wolf D, Gunsilius E, Steurer M, Fong D, et al . Correlation of COX-2 and Ep-CAM overexpression in human invasive breast cancer and its impact on survival. Br J Cancer 2003;88:574-8.  Back to cited text no. 23    
24.Marshall SF, Bernstein L, Anton-Culver H, Deapen D, Horn-Ross PL, Mohrenweiser H, et al . Nonsteroidal anti-inflammatory drug use and breast cancer risk by stage and hormone receptor status. J Natl Cancer Inst 2005;97:805-12.  Back to cited text no. 24    
25.Sucic M, Boban D, Markovic-Glamocak M, Jakic-Razumovic J, Vrbanec D, Ries S, et al . Expression of cyclooxygenase-2 in fine-needle aspirates from breast carcinoma and benign breast diseases. Breast 2003;12:51-7.  Back to cited text no. 25    
26.Subbaramaiah K, Norton L, Gerald W, Dannenberg AJ. Cyclooxygenase-2 is overexpressed in HER 2/neu-positive breast cancer: Evidence for involvement of AP-1 and PEA3. J Biol Chem 2002;277:18649-57.   Back to cited text no. 26    
27.Howe LR, Subbaramaiah K, Brown AM, Dannenberg AJ. Cyclooxygenase-2: A target for the prevention and treatment of breast cancer. Endocr Relat Cancer 2001;8:97-114.  Back to cited text no. 27    
28.Howe LR, Chang SH, Tolle KC, Dillon R, Young LJ, Cardiff RD, et al . HER2/neu-induced mammary tumorigenesis and angiogenesis are reduced in cyclooxygenase-2 knockout mice. Cancer Res 2005;65:10113-9.  Back to cited text no. 28    
29.Natarajan R, Esworthy R, Bai W, Gu JL, Wilczynski S, Nadler J. Increased 12-lipoxygenase expression in breast cancer tissues and cells. Regulation by epidermal growth factor. J Clin Endocrinol Metab 1997;82:1790-8.  Back to cited text no. 29    
30.Liu B, Marnett LJ, Chaudhary A, Ji C, Blair IA, Johnson CR, et al . Biosynthesis of 12(s) hydroxyeicosatetraenoic acid by B16 amelanoic cells is a determinant of their metastatic potential. Lab Invest 1994;70:314-23.  Back to cited text no. 30    


    Figures

[Figure - 1]

    Tables

[Table - 1], [Table - 2], [Table - 3]

This article has been cited by
1 Associations betweenALOX,COX, andCRPpolymorphisms and breast cancer among Hispanic and non-Hispanic white women: The breast cancer health disparities study
Avonne E. Connor,Richard N. Baumgartner,Kathy B. Baumgartner,Christina M. Pinkston,Stephanie D. Boone,Esther M. John,Gabriela Torres- Mejía,Lisa M. Hines,Anna R. Giuliano,Roger K. Wolff,Martha L. Slattery
Molecular Carcinogenesis. 2014; : n/a
[Pubmed] | [DOI]
2 Fatty Acid Metabolites in Rapidly Proliferating Breast Cancer
OæFlaherty, J.T. and Wooten, R.E. and Samuel, M.P. and Thomas, M.J. and Levine, E.A. and Case, L.D. and Akman, S.A. and Edwards, I.J.
PLoS ONE. 2013; 8(5)
[Pubmed]
3 The Obesity-Inflammation-Eicosanoid Axis in Breast Cancer
Linda Vona-Davis,David P. Rose
Journal of Mammary Gland Biology and Neoplasia. 2013;
[Pubmed] | [DOI]
4 Rutin inhibits B[a]PDE-induced cyclooxygenase-2 expression by targeting EGFR kinase activity
Seunghwan Choi,Tae-Gyu Lim,Mun Kyung Hwang,Yoon-A Kim,Jiyoung Kim,Nam Joo Kang,Tae Su Jang,Jun-Seong Park,Myeong Hun Yeom,Ki Won Lee
Biochemical Pharmacology. 2013; 86(10): 1468
[Pubmed] | [DOI]
5 Clinical relevance of cyclooxygenase-2 and matrix metalloproteinases (MMP-2 and MT1-MMP) in human breast cancer tissue
Mohammad A. Mohammad, Ahmed A. Zeeneldin, Zakaria Y. Abd Elmageed, Ebtsam H. Khalil, Said M. E. Mahdy, Hayat M. Sharada, Sabry K. Sharawy, Abdel-Hady A. Abdel-Wahab
Molecular and Cellular Biochemistry. 2012;
[VIEW] | [DOI]
6 Cyclooxygenase-2 and human epidermal growth factor receptor type 2 (HER-2) expression simultaneously in invasive and in situ breast ductal carcinoma [Expressão da ciclo-oxigenase-2 e receptor tipo 2 do fator de crescimento epidérmico humano (HER-2) simultaneamente em carcinoma ductal de mama in situ e invasivo]
Lucarelli, A.P. and Martins, M.M. and Montor, W. and Oliveira, V. and Galvão, M.A.L. and Piato, S.
Sao Paulo Medical Journal. 2011; 129(6): 371-379
[Pubmed]
7 Discovery of potent and selective inhibitors of human platelet-type 12-lipoxygenase
Kenyon, V. and Rai, G. and Jadhav, A. and Schultz, L. and Armstrong, M. and Jameson, J.B. and Perry, S. and Joshi, N. and Bougie, J.M. and Leister, W. and Taylor-Fishwick, D.A. and Nadler, J.L. and Holinstat, M. and Simeonov, A. and Maloney, D.J. and Holman, T.R.
Journal of Medicinal Chemistry. 2011; 54(15): 5485-5497
[Pubmed]
8 Discovery of Potent and Selective Inhibitors of Human Platelet-Type 12- Lipoxygenase
Journal of Medicinal Chemistry. 2011; 54(15): 5485
[VIEW] | [DOI]
9 COX2 overexpression is a prognostic marker for Stage III breast cancer
Hee Sung Kim, Hyeong-Gon Moon, Wonshik Han, Cha Kyung Yom, Woo Ho Kim, Jun Ho Kim, Dong-Young Noh
Breast Cancer Research and Treatment. 2011;
[VIEW] | [DOI]
10 Expression of cyclooxygenase-2 (COX-2) and p53 in neighboring invasive and in situ components of breast tumors
Katia Piton Serra, Luis Otavio Sarian, Raquel Mary Rodrigues-Peres, José Vassallo, Fernando Augusto Soares, Glauce Aparecida Pinto, Isabela Werneck da Cunha, Julia Yoriko Shinzato, Sophie F.M. Derchain
Acta Histochemica. 2011;
[VIEW] | [DOI]
11 Association of a functional polymorphism (Gln261Arg) in 12-lipoxygenase with breast cancer
Prasad, V.V.T.S. and Kolli, P. and Moganti, D.
Experimental and Therapeutic Medicine. 2011; 2(2): 317-323
[Pubmed]
12 Association between polymorphisms of arachidonate 12-lipoxygenase (ALOX12) and schizophrenia in a Korean population
Kim, T. and Kim, H.-J. and Park, J.K. and Kim, J.W. and Chung, J.-H.
Behavioral and Brain Functions. 2010; 6(44)
[Pubmed]
13 The value of COX-2 expression in the prognostic parameters of invasive ductal carcinoma of the breast
Nagehan Ozdemir Barısık, Sevinc Hallac Keser, Aylin Ege Gul, Sibel Sensu, Nilufer Onak Kandemir, Hasan Fehmi Kucuk, Mahmut Gumus, Nimet Karadayı
Medical Oncology. 2010;
[VIEW] | [DOI]
14 ALOX12 gene is associated with the onset of natural menopause in white women :
Pengyuan Liu, Yan Lu, Robert R. Recker, Hong-Wen Deng, Volodymyr Dvornyk
Menopause. 2010; 17(1): 152-156
[Pubmed] | [DOI]
15 Clinical use and pharmacological properties of selective COX-2 inhibitors
Shi, S. and Klotz, U.
European Journal of Clinical Pharmacology. 2008; 64(3): 233-252
[Pubmed]
16 Clinical use and pharmacological properties of selective COX-2 inhibitors
Shaojun Shi,Ulrich Klotz
European Journal of Clinical Pharmacology. 2008; 64(3): 233
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
Previous article Next article

    

  Site Map | What's new | Copyright and Disclaimer
  Online since 1st April '07
  © 2007 - Indian Journal of Cancer | Published by Wolters Kluwer - Medknow