Indian Journal of Cancer
Home  ICS  Feedback Subscribe Top cited articles Login 
Users Online :526
Small font sizeDefault font sizeIncrease font size
Navigate here
  Search
 
  
Resource links
 »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
 »  Article in PDF (1,195 KB)
 »  Citation Manager
 »  Access Statistics
 »  Reader Comments
 »  Email Alert *
 »  Add to My List *
* Registration required (free)  

 
  In this article
 »  Abstract
 » Introduction
 »  Materials and Me...
 » Results
 » Discussion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed2972    
    Printed67    
    Emailed3    
    PDF Downloaded671    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 50  |  Issue : 3  |  Page : 175-183
 

Cell-free DNA concentration and integrity as a screening tool for cancer


1 Department of Radiation Sciences, Medical Research Institute, Alexandria University, Alexandria, Egypt
2 Department of Experimental and Clinical Surgery, Medical Research Institute, Alexandria University, Alexandria, Egypt
3 Department of Cancer Research and Management, Medical Research Institute, Alexandria University, Alexandria, Egypt
4 Department of Applied Medical Chemistry, Medical Research Institute, Alexandria University, Alexandria, Egypt

Date of Web Publication23-Sep-2013

Correspondence Address:
Ebtsam R Zaher
Department of Radiation Sciences, Medical Research Institute, Alexandria University, Alexandria
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0019-509X.118721

Rights and Permissions

 » Abstract 

Aim of the Study: This study aims to evaluate cell-free DNA (CFDNA) concentration and integrity in patients with malignant and nonmalignant diseases and in controls to investigate their value as a screening test for cancer, and to correlate them with clinicopathological parameters of cancer patients. Materials and Methods: The study included three groups; group I: 120 cancer patients, group II: 120 patients with benign diseases and group III: 120 normal healthy volunteers as control. One plasma sample was collected from each subject. CFDNA was purified from the plasma then its concentration was measured and integrity was assessed by PCR amplification of 100, 200, 400, and 800 bp bands. Results: There was a highly significant difference in CFDNA levels between cancer group and each of benign and control groups. AUC of ROC curve for cancer group versus normal and benign groups were 0.962 and 0.895, which indicated the efficiency of CFDNA as a marker of cancer. As for integrity, normal and benign subjects showed only two bands at 100 and 200 bp, while all cancer patients demonstrated the 400 bp band and 78% of them had the 800 bp whose presence correlated with vascular invasion. Conclusion: The combined use of CFDNA concentration and integrity is a candidate for a universal screening test of cancer. Upon setting suitable boundaries for the test it might be applied to identify cancer patients, particularly among subjects with predisposing factors. Being less expensive, CFDNA concentration could be applied for mass screening and for patients with values overlapping those of normal and benign subjects, the use of the more expensive, yet more specific, integrity test is suggested.


Keywords: Cancer, cell-free DNA, DNA integrity, screening


How to cite this article:
Zaher ER, Anwar MM, Kohail HM, El-Zoghby SM, Abo-El-Eneen MS. Cell-free DNA concentration and integrity as a screening tool for cancer. Indian J Cancer 2013;50:175-83

How to cite this URL:
Zaher ER, Anwar MM, Kohail HM, El-Zoghby SM, Abo-El-Eneen MS. Cell-free DNA concentration and integrity as a screening tool for cancer. Indian J Cancer [serial online] 2013 [cited 2019 Aug 20];50:175-83. Available from: http://www.indianjcancer.com/text.asp?2013/50/3/175/118721



 » Introduction Top


Cancer is a major public health problem worldwide. In the United States, It is the second most common cause of death and it accounted for 1 of every 4 deaths in 2008. [1] In 2007, 11 million new cancer cases and 7.4 million cancer deaths were reported worldwide; leaving nearly 25 million persons living with cancer. More than 70% of all cancer deaths occurred in low- and middle-income countries. Deaths from cancer worldwide are projected to continue rising, with an estimated 12 million deaths in 2030. [2],[3]

In Egypt, in the years 1999 to 2001 the age standardized incidence rates of breast cancer was 49.6/100 000 females. [4] In the Egyptian mortality statistics in 2001, breast cancer was the fourth most common cause of death, accounting for 9.3% of all cancer deaths and 21.0% of women cancer deaths. [5]

A sensitive assay that can accurately diagnose the onset of cancer using noninvasively collected clinical specimens is ideal for early detection. The earlier and more accurate the diagnostic biomarker can predict disease onset, the more valuable it becomes. [6] Since cancer symptoms usually appear when tumors are sufficiently large, so, for detection of cancer to be early, it has to uncover tumors in asymptomatic individuals. Early detection reduces the suffering and cost to society associated with the disease. The better clinical outcomes associated with early detection highlight the need for and the potential benefit of early detection of cancer. [7],[8]

Cell-free DNA (CFDNA) is extracellular nucleic acids found in cell-free plasma/serum of humans. There are several terms in use like circulating nucleic acids, extracellular nucleic acids or cell-free nucleic acids. [9] Circulating extracellular DNA can be found in healthy persons, persons with nonmalignant diseases, as well as persons with various malignancies. In addition, trauma and therapeutic procedures may also lead to the release of free DNA into the circulation. It is likely that a significant proportion is bound to protein molecules, possibly as nucleosomes. [10],[11] Theoretically, circulating DNA is mostly released from degrading cells after cleavage by endonucleases that cut the chromatin into the basic nucleosomes, which conserves them from proteolytic digestion in blood. [12]

In a healthy person, it is believed that CFDNA enters circulation via apoptosis of lymphocytes and other nucleated cells. [13] Apoptosis has a distinctive DNA "ladder" pattern that showed specific banding at 200 bp that resulted from endonuclease-mediated double-strand cleavage between nucleosomes. [14],[15],[16] While in cancer patients, CFDNA most likely result from tumor necrosis, but other suggested mechanisms include lysis of circulating cancer cells or of micro-metastases, or due to active release. [17] Necrosis generates a spectrum of DNA fragments with different strand lengths, mostly large DNA fragments, because of random and incomplete digestion of genomic DNA by DNases. [18]

The current work aims to quantitatively evaluate the levels of plasma DNA and to determine its integrity in patients with malignant and non-malignant diseases and in healthy controls to investigate whether they are of value as a screening test for cancer, and also to correlate them with various clinicopathological parameters.


 » Materials and Methods Top


This prospective cohort study included 360 subjects divided into three groups:

Group I: included 120 patients newly diagnosed with cancer of different types (25 breast, 20 lung, 20 colon, 20 stomach and 20 HCC cancers and 15 lymphoma).

Group II: included 120 patients with various benign diseases (excluding autoimmune diseases) of matched age and sex to group I (21 benign breast lump, 13 colitis, 18 benign colonic polyps, 17 duodenal ulcers, 23 cirrhosis, 5 obstructive lung disease, 13 benign lung tumor and 10 inguinal hernia).

Group III: included 120 normal healthy volunteers of matched age and sex to group I, as controls.

Patients were randomly recruited during the period from January 2007 to December 2008. All patients provided an informed written consent and the study was approved by the Local Research Ethics Committee.

Patients were subjected to standard clinical procedure according to the type of disease; these include thorough clinical examination, preoperative evaluation by FNAC, endoscopy or excision biopsy, full medical history taking and full routine laboratory and radiological investigations.

Breast, colonic, and gastric carcinoma patients underwent surgery. Modified radical mastectomy was done to all 25 breast cancer patients. Right hemicolectomy was done to six patients, left hemicolectomy was done to seven patients, and anterior resection was done to seven patients with colonic carcinoma. Subtotal gastrectomy was done to 12 patients and total gastrectomy to 8 patients with gastric carcinoma. Lymph nodes excisional biopsies was done for lymphoma patients. All patients received their standard adjuvant chemotherapy according to the type of cancer they had. Exclusion criteria included cancer patients with previous treatment of any kind and patients with autoimmune and viral diseases.

One random blood sample was collected in EDTA-containing tubes, from patients before surgery or treatment and from controls. Blood was centrifuged at 6000 rpm for 10 min at 4°C. Plasma samples were kept frozen at -80°C until the time of assay to detect total cell free concentration and integrity. [19]

DNA extraction from serum was performed using NucleoSpin® Plasma XS kit (Macherey-Nagel GmbH & Co KG, Germany) according to the manufacturer's instructions. Briefly, 20 μl proteinase K were added to 240 μl plasma, incubated at 37°C for 5 min. To the mixture, 360 μl of Binding Buffer were added, mixed for 60 s, then loaded to the column and centrifuged at 6000 rpm for 30 s then at 12 000 rpm for 5 s. The column was washed twice and 30 μl of Elution Buffer were added and left for 10 min. DNA was collected by centrifugation at 12 000 rpm for 30 s. The elution fraction was incubated with open lid for 8 min at 90°C.

CFDNA concentrations of extracted samples were measured using Quant-iT TM PicoGreen dsDNA Assay Kit (Invitrogen Detection Technologies) according to the manufacture's instructions. Calf thymus DNA (100 mg/ml) was used as a standard to prepare serial dilutions (0 to 1000 ng/ml) to plot a standard curve. Fluorescence intensity was measured in a spectrofluorometer at emission wavelength of 520 nm and excitation wavelength of 480 nm.

The integrity of CFDNA was examined by PCR. Three fragments were amplifed of 200, 400, and 800 bp for p-53 gene and a 100 bp b-actin fragment as a house keeping gene. PCR was carried out using Go Taq®Green Master Mix (Promega Corporation-Madison, WI, USA). Each PCR reaction mixture consisted of 10 μl PCR master mix; 1 μl of each amplification primer 4 μM (4 pmol/μl) and 250 ng DNA extract and the volume was brought to 20 μl by deionized water. Thermal cycling started by a first denaturation step of 4 min at 95 °C, followed by 45 cycles of 95 °C for 30 s, 58 °C for 60 s and 72 °C for 60 s and a final extention at 72 °C for 10 minutes. Two separate amplifications were used one for b-actin with primer sequences: F-GCACCACACCTTCTACAATGA and R-GTCATCTTCTCGCGGTTGGC, and the second for p-53 gene using one forward primer; F-CACCTCCACCACCTCCTCAA, and three reverse primers; R1-GTATCAGCATCTGGAAGAA at 200 bp, R2-CATCATCATCTGAATCATCT at 400 bp and R3- TCACCTGACTGTGCTCCTCC at 800 bp. PCR products were separated by gel electrophoresis, stained by ethedium bromide and visualized by UV.

Standard serum tumor markers for each type of cancer were also evaluated. For breast cancer patients, CA 15.3 was measured using a commercial immunoradiometric assay (IRMA) kit (DIAsource ImmunoAssays S.A. - Belgium). For lung cancer patients, CYFRA 21-1 was measured using a commercial IRMA kit (SIS Bio International, Schering S.A., France). For colon and gastric cancer patients CA 19.9 was measured using a commercial IRMA kit (DIAsource ImmunoAssays S.A. - Belgium). For HCC patients AFP was measured using a commercial IRMA kit (DIAsource ImmunoAssays S.A. - Belgium). All tests were carried out according to the manufacturers' instructions and using the materials supplied in the kit.

Statistical analysis was performed using the SPSS (Statistical Package for the Social Sciences) software package, version 19.0 (SPSS Inc., Chicago, IL, USA).

Mean values were comparisons by Mann-Whitney U-test. A P value of less than 0.05 was considered as statistically significant. Qualitative variables were compared using the c 2 test and Fisher's exact test. Two-tailed P values of less than 0.05 were considered statistically significant. The relationships between the amount of DNA in the plasma and clinicopathological parameters were determined by Pearson correlation analysis.

A receiver operating characteristic curve (ROC) was used to evaluate the diagnostic performance of CFDNA concentrations. Each unique DNA value was used as a cut point to calculate sensitivity and specificity values defining the curve and the area under the curve (AUC). A P value less than 0.05 (two tailed) was considered significant. Standard errors (SEs) were estimated separately to provide a 95% CI for the area.


 » Results Top


The mean age of the subjects included in this study was represented as mean ± standard error (M ± SE). M ± SE of age in cancer patients were 53.9 ± 1.6 years ranging from 32 to 75 years. While, the M ± SE of age in benign and control groups were 48.7 ± 3.6, 49.8 ± 4.7 years, respectively. Age range in benign and control groups was 37-60 and 38-63 years, respectively. There were no statistically significant differences in the mean age between the three groups.

[Table 1] represents plasma CFDNA levels in cancer, benign and control groups. The Median (range) for cancer group was 578 ng/ml (59-4891) and for benign and control groups were 87 ng/ml (16-597), and 52 ng/ml (0-305), respectively.
Table 1: Levels of plasma DNA (ng/ml) in cancer, benign, and control groups and in cancer subgroups

Click here to view


The plasma DNA level of cancer group was significantly higher than that of the benign and control groups (P 0.001 and P < 0.001, respectively), but there was no statistically significant difference between benign and control groups (P = 0.119).

According to tumor site; cancers were breast, lung, colon, stomach, HCC, and lymphoma. The median (range) for each of them was: 725 ng/ml (105-489), 584 ng/ ml (186-2037), 508 ng/ml (229-1550), 593 ng/ml (232- 1111), 460 ng/ml (59-968), and 899 ng/ml (171- 2660), respectively. There was a statistically significant difference in the mean level of plasma DNA between all cancer subgroups; breast, lung, colon, stomach, HCC and lymphoma subgroups and each of the control group (P < 0.001, 0.003, 0.008, 0.003, 0.020, and <0.001, respectively), and the benign group (P = 0.001, 0.014, 0.016, 0.013, 0.020, and <0.001, respectively).

[Figure 1] represents the ROC curve of plasma DNA concentrations for discriminating cancer from control subjects with a statistically asymptotic significance of P < 0.001 and an area under the curve (AUC) of 0.962, and for discriminating cancer and benign groups with statistically asymptotic significance of P < 0.000, and AUC of 0.895. All cancer subgroups individually showed high asymptomatic significance from both benign and control groups. AUC of ROC curves for the cancer subgroups against normal and benign groups were as follow; breast "0.962, 0.923", lung "1.0, 0.949", colon :0.971, 0.918", stomach "0.985, 0.962", HCC "0.920, 0.871", and lymphoma "0.950, 0.929" [Figure 2].
Figure 1: ROC curve for discrimination between (a) cancer and control, and (b) cancer and benign groups

Click here to view
Figure 2: ROC curve for discrimination between various cancer subgroups and control (solid line) and benign (dotted line) groups

Click here to view


[Table 2] represents ROC curve values for CFDNA versus control and benign groups, Cutoff values of CFDNA with their sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV). We selected two cutoffs, the first at 100 ng/ml; with 100% sensitivity and 75% specificity; was obtained from ROC curve of cancer group versus control group that has 100% NPV. All study subjects with lower CFDNA than 100 ng/ml are negative for cancer. The other cutoff at 600 ng/ml; with 100% specificity and 54.0% sensitivity; was obtained from ROC curve of cancer group versus benign group, that has 100% PPV. All study subjects with higher CFDNA than 600 ng/ml are positive for cancer.
Table 2: ROC curve values for CFDNA versus control and benign groups, showing Area Under each Curve different, significance, cutoff values of plasma DNA with their sensitivity, specificity, positive predictive value, and negative predictive value

Click here to view


CFDNA integrity was assessed by PCR amplification of four fragments of 100, 200, 400, and 800 bp. The first two bands would measure apoptotic CFDNA while the latter two, would measure necrotic CFDNA originating from cancer. [Figure 3] represent the electrophoresis of PCR products, showing the 100, 200, 400, and 800 bp fragments. Both the 100 and 200 bp fragments were present in all subjects of the study. While the 400 bp band was present in all cancer cases but not in any of the benign or control subjects, as represented in [Figure 4]a. While the 800bp fragment was present in only half of breast cancer cases and 64.3% of lung cancers, it was present in all HCCs, colon cancers and lymphomas; [Figure 4]b.
Figure 3: Electrophoresis for PCR products showing; (a) negative control sample (lane 2), one sample of a control subject showing 100 bp β -actin fragment (lane 1) and 200 bp fragment (lane 3) and two cancer samples showing 200, 400 and 800 bp fragments (lanes 4 and 5); (b) two cancer patients show the 100 bp fragment (lanes 1 and 2) and 200, 400 and 800 bp fragments (lanes 4 and 5)

Click here to view
Figure 4: (a) Percent of cases with 100, 200, 400 and 800 bp fragments in cancer, benign and control groups; (b) percent of cases with 800 bp fragment in cancer subgroups

Click here to view


Clinicopathological parameters of breast, colon and gastric carcinoma groups combined were correlated with CFDNA concentration and integrity. There was no correlation between CFDNA concentration or integrity with clinicopathological parameters; including pathological stage, histological grade, tumor size, lymph node metastases and vascular invasion. However, the 800 pb band expression showed a strong positive correlation with vascular invasion, r = 0.940, P= 0.005, [Table 3].
Table 3: Correlation between plasma DNA levels and clinicopathological parameters

Click here to view


Conventional tumor markers related to each cancer type were evaluated and compared in each cancer type to both benign and control subjects as one group, results are presented in [Table 4]. ROC curves of each tumor marker revealed that each of them was suitable for diagnosis of its respective cancer, yet CFDNA is by far a better diagnostic marker than any of them. CA 15.3, CA 19.9 and AFP did not show statistically significant relation with CFDNA concentration or integrity. However, Cyfra 21.1 in lung cancer patients, which was significantly correlated with CFDNA (P = 0.047, 95% CI: 1.02, 4.06). Absence of other significant correlations is most probably because of the small sample size of each individual type of cancer.
Table 4: Conventional tumor markers routinely used in cancer diagnosis in cancer patients and control group, cutoff, sensitivity, specificity and AUC

Click here to view



 » Discussion Top


Cancer diagnosis often requires tumor biopsies obtained by invasive methods, and the current screening methods fail to detect many cancers at early stages, leading to cancers being presented at later stages when clinical symptoms start showing. 7],[8] Therefore, there is a need for a screening tool to detect cancer in early stages. A screening test should be safe, cheap, highly specific and sensitive, with a high predictive value that can easily and quickly be used in a large population to detect the disease with a proven benefit. [7],[8]

The most promising as cancer-screening marker is circulating cell-free DNA (CFDNA). [20] Previous studies suggested that elevated plasma DNA levels may predict neoplastic disease through two aspects. First, the amount of CFDNA in plasma or serum of cancer patients is more than that in healthy individuals. Second, alterations that can be detected in primary tumors can also be detected in CFDNA of a cancer patient. [13],[21] Different hypotheses explained the origin of CFDNA. It is supposed to be released through necrosis or apoptosis, [17],[22],[23] actively released from cells [17],[24] or it may be the result of the sum of many different mechanisms. [17],[25],[26] But the actual origin of CFDNA remains enigmatic.

The goal of this study is to quantify the level of plasma CFDNA and to determine its integrity in patients with cancer and benign diseases and in healthy controls to investigate their value as a screening test for cancer.

In the current study, the mean level of CFDNA in cancer group was about 10-fold that of control group and about fivefold that of benign group. This may be due to the release of a substantial amount of genomic DNA into the systemic circulation from tumor cells either by necrosis or active release. [17],[21] Another hypothesis referred it to suppressed DNase activity in sera of cancer patients as an E. coli DNase has almost no activity in plasma from cancer patients, while in plasma of healthy controls the same DNase seems to work as good as in a culture medium. [27] However, there was no statistically significant difference in the mean level of CFDNA between benign and control subjects. This perhaps could be attributed to the exclusion of patients with diseases that are suspected to increase CFDNA concentrations as autoimmune or viral diseases.

To verify whether this applies to each cancer type individually, cancer patients were divided into six subgroups according to tumor site; these are; stomach, lung, breast, HCC and colon cancers, and lymphoma. We found that CFDNA levels in all subgroups were significantly higher than the control and the benign groups.

Previous studies were consistent with our finding of increased CFDNA level in various cancer patients than that of control and benign subjects, and most of them confirmed the high accuracy of CFDNA levels in discriminating cancer patients from normal subjects. [28],[29],[30],[31],[32] However, the study design including selection of patient and control groups and the way clinical blood samples were handled before reaching the laboratory had a significant impact on CFDNA yields, as well as, the methods used to extract and quantify CFDNA. All these factors make for considerable variations between studies and difficulty to compare the values reported by different research groups.

To test the accuracy, sensitivity and specificity of using CFDNA as a screening tool, we used ROC curve of cancer patients against both benign and control groups. This indicated that CFDNA represented a highly sensitive and specific marker to discriminate cancer patients from control and benign individuals. When compared to conventional tumor markers used in various types of cancer diagnosis (CA 15.3 for breast cancer, AFP for HCC, CA 19.9 for colon and gastric carcinoma and Cyfra 21.1 for lung cancer), CFDNA was by far, better than any of them in their respective cancer types. In addition, using a single test for all cancer types is much easier and more applicable than using as many tests as cancer types themselves.

CFDNA levels in cancer, benign and control groups showed a high degree of overlap, which might limit its value in application. To define the overlap range, two cutoff points were defined. The cutoff point from the ROC curve of cancer versus control groups was 100 ng/ml, with 75% specificity and 100% sensitivity, a cutoff at which no false positives occurred and all subjects below this CFDNA concentration are not cancer patients. Another cutoff value was selected from ROC curve of cancer against benign groups of 600 ng/ml, which gave a corresponding 100% specificity and 53.4% sensitivity, at this cutoff point no false negative results were obtained. Thus, patient with CFDNA >600 ng/ml could be directly diagnosed as cancer patient. However, patients that had CFDNA concentrations, between 100 and 600 ng/ml, could not be confirmed as cancer patients or none, because of the overlap with benign subjects. CFDNA integrity was used to resolve this discrepancy.

CFDNA integrity is defined as the presence of larger DNA fragments in blood with different lengths or sizes >200 bp. [33] Benign patients and control subjects showed bands at 100 and 200 bp only, corresponding to the presence of shorter apoptotic DNA fragments, while all cancer patients demonstrated the 400 bp band and approximately 78% of them represented the 800 bp band as well. Thus, longer DNA fragments were present in all cancer patient samples, while they were absent from benign and control subjects. These results were consistent with many previous studies that revealed an increase of predominantly large DNA fragments in patients with breast, [28] colon, [29] lung, [20] prostate, [34] head and neck, [35] and renal cell carcinomas [31] among many others.

Our results did not reveal any correlations between clinicopathological parameters (e.g., tumor size, stage, grade, metastasis, etc.) and CFDNA concentration or integrity. However, the 800 pb band expression showed a strong positive correlation with vascular invasion. That may be explained by the fact that DNA released from malignant tumors into the bloodstream was enhanced by vascular invasion, so direct lymphatic or blood flow through the tumors enabled dissemination of viable tumor cells and enhanced diffusion of DNA released from necrotic or living tumor cells into the bloodstream. [36]

Many other studies also reported that there was no correlation of CFDNA integrity with any clinicopathological parameters in various cancer types, which is consistent with our findings. [13],[22],[37],[38],[39] On the other hand, Umetani and his colleagues [38] found that DNA integrity was positively correlated to size of invasive cancers and significantly higher in the presence of lymphovascular invasion and lymph node metastasis. [36] We are inclined to believe that higher levels of CFDNA in serum of cancer patients could result from balance between one or more sources of release with the reduced clearance. The most probable source is active release from living tumor cells rather than dying ones, at least in early stages of the disease. The presence of many contributing factors as coming from multiple sources, reduced clearance, the possible contribution from other nucleated blood cells does not make the tumor the sole factor to account for when considering CFDNA levels, and may, at least partially, explain the lack of correlation between CFDNA and clinicopathological parameters.

Notably, however, in HCC and colon subgroups, where almost 40% of patients had low CFDNA concentrations resulting in lower mean CFDNA levels, yet, they had high CFDNA integrity (800 bp band was present in all cases of these two subgroups). In other words, in colon and liver cancers, alterations in DNA quality (fragmentation) rather than quantity (concentrations) may better characterize tumor-released DNA. Also, breast cancer that had the highest CFDNA concentration, it had the lowest percent of 800 bp expression.

Screening for cancer in a large population, currently, needs the combination of many techniques, including clinical, radiographic, pathological and laboratory workup, which is both money and time consuming. However, in the current study we used one blood sample to identify cancer patients by measuring concentration and integrity of plasma DNA which could be simple, sensitive, specific, noninvasive, inexpensive and reproducible. So, CFDNA test has the potential to be an ideal screening tumor marker that can be used to identify cancer among subjects who may be susceptible to have cancer, particularly subjects with familial history of cancer or with predisposing factors.

The test might be done in two steps. The first step includes extraction and quantification of CFDNA. CFDNA being less than 100 ng/ml might be indicative of no malignancy present and a subject may be diagnosed as cancer patient if CFDNA >600 ng/ml. If CFDNA falls between 100 and 600 ng/ml, further confirmation might be needed. The second step is the detection of CFDNA integrity. The appearance of larger fragments (400 bp) could indicate the presence of cancer.

However, this test needs to be further validated on a larger scale study before it can be applied to a large population, also to further define the inclusion and exclusion criteria that enable the use of CFDNA as a screening test for malignancy.

 
 » References Top

1.American Cancer Society. Cancer Facts & Figures 2008. Atlanta: American Cancer Society; 2008.  Back to cited text no. 1
    
2.Farin K, Graça MD, William FA. Patterns of cancer incidence, mortality, and prevalence across five continents: Defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 2006;24:2137-50.  Back to cited text no. 2
    
3.Boyle P, Levin B. World cancer report 2008. IARC Non serial Publication, IARC; Lyon: International Agency for Research on Cancer; 2008. p9.  Back to cited text no. 3
    
4.Freedman LS, Edwards BK, Ries LAG, Young JL, editors. Cancer Incidence in Four Member Countries (Cyprus, Egypt, Israel, and Jordan) of the Middle East Cancer Consortium (MECC) Compared with US SEER. National Cancer Institute, 2006.. NIH Pub. No. 06-5873. Bethesda, MD;  Back to cited text no. 4
    
5.Elattar I. Breast cancer, magnitude of the problem: Egyptian society of surgical oncology conference. Taba, Sinai, Egypt; (30 March - 1 April 2005). http://www.docstoc.com/docs/44720076/Breast-Cancer-Magnitude-of-the-Problem   Back to cited text no. 5
    
6.Levenson VV. Biomarkers for early detection of breast cancer: What, when, and where? Biochim Biophys Acta 2007;1770:847-56.  Back to cited text no. 6
[PUBMED]    
7.Etzioni R, Urban N, Ramsey S, McIntosh M, Schwartz S, Reid B, et al. The case for early detection. Nat Rev Cancer 2003;3:243-52.  Back to cited text no. 7
[PUBMED]    
8.Harris R, Kinsinger LS. Principles of screening for cancer. In: Chang AE, Hayes DF, Pass HI, Stone RM, Ganz PA, Kinsella TJ, et al., editors. Oncology: An Evidence-based Approach. New York: Springer; 2006. p. 161-76.  Back to cited text no. 8
    
9.Fleischhacker M, Schmidt B. Circulating nucleic acids (CNAs) and cancer-A survey. Biochim Biophys Acta 2007;1775:181-232.  Back to cited text no. 9
[PUBMED]    
10.Laktionov PP, Tamkovich SN, Rykova EY, Bryzgunova OE, Starikov AV, Kuznetsova NP. Extracellular circulating nucleic acids in human plasma in health and disease. Nucleosides Nucleotides Nucleic Acids 2004;23:879-83.  Back to cited text no. 10
    
11.Holdenrieder S, Stieber P. Clinical use of circulating nucleosomes. Crit Rev Clin Lab Sci 2009;46:1-24.  Back to cited text no. 11
[PUBMED]    
12.Lichtenstein AV, Melkonyan HS, Tomei LD, Umansky SR. Circulating nucleic acids and apoptosis. Ann N Y Acad Sci 2001;945:239-49.  Back to cited text no. 12
[PUBMED]    
13.Swarup V, Rajeswari MR. Circulating (cell-free) nucleic acids-A promising, non-invasive tool for early detection of several human diseases. FEBS Lett 2007;581:795-9.  Back to cited text no. 13
[PUBMED]    
14.Khan N, Adhami VM, Mukhtar H. Apoptosis by dietary agents for prevention and treatment of cancer. Biochem Pharmacol 2008;76:1333-9.  Back to cited text no. 14
[PUBMED]    
15.Danial NN, Korsmeyer SJ. Cell death: Critical control points. Cell 2004;116:205-19.  Back to cited text no. 15
[PUBMED]    
16.Nagata S, Nagase H, Kawane K, Mukae N, Fukuyama H. Degradation of chromosomal DNA during apoptosis. Cell Death Differ 2003;10:108-16.  Back to cited text no. 16
[PUBMED]    
17.Stroun M, Maurice P, Vasioukhin V, Lyautey J, Lederry C, Lefort F, et al. The origin and mechanism of circulating DNA. Ann NY Acad Sci 2000;906:161-8.  Back to cited text no. 17
    
18.Krysko DV, Berghe TV, Herde KD, Vandenabeele P. Apoptosis and necrosis: Detection, discrimination and phagocytosis. Methods 2008; 44:205-21.  Back to cited text no. 18
    
19.Sozzi G, Conte D, Leon EM, Cirincione R, Roz L, Ratcliffe C, et al. Quantification of free circulating DNA as a diagnostic marker in lung cancer. J Clin Oncol 2003;21:3902-8.  Back to cited text no. 19
    
20.Zhang R, Shao F, Wu X, Ying K. Value of quantitative analysis of circulating cell free DNA as a screening tool for lung cancer: A meta-analysis. Lung Cancer 2010;69:225-31.  Back to cited text no. 20
[PUBMED]    
21.Van der Vaart M, Pretorius PJ. Is the role of circulating DNA as a biomarker of cancer being prematurely overrated? Clin Biochem 2010;43:26-36.  Back to cited text no. 21
[PUBMED]    
22.Gormally E, Caboux E, Vineis P, Hainaut P. Circulating free DNA in plasma or serum as biomarker of carcinogenesis: Practical aspects and biological significance. Mutat Res 2007;635:105-17.  Back to cited text no. 22
[PUBMED]    
23.Pinzani P, Salvianti F, Pazzagli M, Orlando C. Circulating nucleic acids in cancer and pregnancy. Methods 2010;50:302-7.  Back to cited text no. 23
[PUBMED]    
24.Stroun M, Lyautey J, Lederrey C, Olson-Sand A, Anker P. About the possible origin and mechanism of circulating DNA: Apoptosis and active DNA release. Clin Chim Acta 2001;313:139-42.  Back to cited text no. 24
[PUBMED]    
25.Garcia-Olmo DC, Ruiz-Piqueras R, Garcia-Olmo D. Circulating nucleic acids in plasma and serum (CNAPS) and its relation to stem cells and cancer metastasis: State of the issue. Histol Histopathol 2004;19:575-83.  Back to cited text no. 25
    
26.Sidransky D. Circulating DNA what we know and what we need to learn. Ann N Y Acad Sci 2000;906:1-4.  Back to cited text no. 26
[PUBMED]    
27.Leon SA, Shapiro B, Servi P, Parsons RG. A comparison of DNA and DNA-binding protein levels in malignant disease. Eur J Cancer 1981;17:533-8.  Back to cited text no. 27
[PUBMED]    
28.Huang ZH, Li LH, Hua D. Quantitative analysis of plasma circulating DNA at diagnosis and during follow-up of breast cancer patients. Cancer Lett 2006;243:64-70.  Back to cited text no. 28
[PUBMED]    
29.Lecomte T, Ceze N, Dorval E, Laurent-Puig P. Circulating free tumor DNA and colorectal cancer. Gastroenterol Clin Biol 2010;34:662-81.  Back to cited text no. 29
[PUBMED]    
30.Gormally E, Hainaut P, Caboux E, Airoldi L, Autrup H, Malaveille C, et al. Amount of DNA in plasma and cancer risk: A prospective study. Int J Cancer 2004;111:746-9.  Back to cited text no. 30
[PUBMED]    
31.Hauser S, Zahalka T, Ellinger J, Fechner G, Heukamp LC, VON Ruecker A, et al. Cell-free circulating DNA: Diagnostic value in patients with renal cell cancer. Anticancer Res 2010;30:2785-9.  Back to cited text no. 31
[PUBMED]    
32.Lavon I, Refael M, Zelikovitch B, Shalom E, Siegal T. Serum DNA can define tumor-specific genetic and epigenetic markers in gliomas of various grades. Neuro Oncol 2010;12:173-80.  Back to cited text no. 32
[PUBMED]    
33.Wang BG, Huang HY, Chen YC, Bristow RE, Kassauei K, Cheng CC, et al. Increased plasma DNA integrity in cancer patients. Cancer Res 2003;63:3966-8.  Back to cited text no. 33
[PUBMED]    
34.Ellinger J, Müller SC, Stadler TC, Jung A, von Ruecker A, Bastian PJ. The role of cell-free circulating DNA in the diagnosis and prognosis of prostate cancer. Urol Oncol 2011;29:124-9.  Back to cited text no. 34
    
35.Jiang W, Zahurak M, Goldenberg D, Milman Y, Park HL, Westra WH, et al. Increased plasma DNA integrity index in head and neck cancer patients. Int J Cancer 2006;119:2673-6.  Back to cited text no. 35
    
36.Umetani N, Giuliano AE, Hiramatsu SH, Amersi F, Nakagawa T, Martino S, et al. Prediction of breast tumor progression by integrity of free circulating DNA in serum. J Clin Oncol 2006;24:4270-6.  Back to cited text no. 36
    
37.Ellinger J, Bastian PJ, Ellinger N, Kahl P, Perabo FG, Büttner R, et al. Apoptotic DNA fragments in serum of patients with muscle invasive bladder cancer: A prognostic entity. Cancer Lett 2008;264:274-80.  Back to cited text no. 37
    
38.Sozzi G, Conte D, Mariani L, Vullo SL, Roz L, Lombardo C, et al. Analysis of circulating tumor DNA in plasma at diagnosis and during follow-up of lung cancer patients. Cancer Res 2001;61:4675-8.  Back to cited text no. 38
    
39.Paci M, Maramotti S, Bellesia E, Formisano D, Albertazzi L, Ricchetti T, et al. Circulating plasma DNA as diagnostic biomarker in non-small cell lung cancer. Lung Cancer 2009;64:92-7.  Back to cited text no. 39
[PUBMED]    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
Print this article  Email this article
 

    

  Site Map | What's new | Copyright and Disclaimer
  Online since 1st April '07
  © 2007 - Indian Journal of Cancer | Published by Wolters Kluwer - Medknow