Indian Journal of Cancer
Home  ICS  Feedback Subscribe Top cited articles Login 
Users Online :451
Small font sizeDefault font sizeIncrease font size
Navigate here
  Search
 
  
Resource links
 »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
 »  Article in PDF (617 KB)
 »  Citation Manager
 »  Access Statistics
 »  Reader Comments
 »  Email Alert *
 »  Add to My List *
* Registration required (free)  

 
  In this article
 »  Abstract
 » Introduction
 » Subjects and Methods
 » Results
 » Discussion
 » Acknowledgment
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed1635    
    Printed57    
    Emailed0    
    PDF Downloaded353    
    Comments [Add]    
    Cited by others 2    

Recommend this journal

 

  Table of Contents  
GASTROINTESTINAL CANCER SYMPOSIUM - ORIGINAL ARTICLE
Year : 2014  |  Volume : 51  |  Issue : 3  |  Page : 352-357
 

Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis


1 Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2 Department of biology, Sanandaj Branch, Islamic Azad University, Sanandaj, Tehran, Iran
3 Gastroenterology and Liver Disease Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Date of Web Publication10-Dec-2014

Correspondence Address:
M Montazer Haghighi
Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0019-509X.146758

Rights and Permissions

 » Abstract 

Context: Familial adenomatous polyposis (FAP) is one type of hereditary colon cancer with a large number of precancerous polyps that initiation to growth in childhood and adolescent. Mutation in adenomatous polyposis coli (APC) gene is the cause of FAP. Aims: The aim of the current study was to standardize multiplex ligation probe amplification (MLPA) method in screening of APC large deletions for the first time in Iranian patients with FAP. Subjects and Methods: Deoxyribonucleic acid was extracted from 34 FAP patients by saluting out method. All patients were screened for APC large deletions whit MLPA and for the positive results, respective region was investigated by polymerase chain reaction sequencing. All genetic alterations were doubled checked in two separated rounds of MLPA. Results: The detection rate of large fragment deletions in APC was 5.8% (2/34). Both of the Iranian patients had deletion in the middle and the end of exon 15, however, comparing of clinical features between patient with the large deletion and patients without deletion did not show any significant difference in each variable including, age at diagnosis, signs of disease and poly type. Conclusions: It seems that exon 15 of APC gene is probably the hotspot region in Iranian FAP patients. Association of genotype/phenotype is well known in FAP patients, but in this study statistical analyses did not show a significant difference in each considerable factor between patients with and without large deletions. It seems better to consider MLPA as an initial step to screening APC mutations.


Keywords: Adenomatous polyposis coli, familial adenomatous polyposis, large deletion, multiplex ligation probe amplification


How to cite this article:
Kishani Farahani R, Montazer Haghighi M, Asadzadeh Aghdaei H, Keshavarzi F, Taleghani M Y, Goodarzi F, Nazemalhosseini-Mojarad E, Zali M R. Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis . Indian J Cancer 2014;51:352-7

How to cite this URL:
Kishani Farahani R, Montazer Haghighi M, Asadzadeh Aghdaei H, Keshavarzi F, Taleghani M Y, Goodarzi F, Nazemalhosseini-Mojarad E, Zali M R. Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis . Indian J Cancer [serial online] 2014 [cited 2019 Dec 5];51:352-7. Available from: http://www.indianjcancer.com/text.asp?2014/51/3/352/146758



 » Introduction Top


Colorectal cancer (CRC) is the third most common malignant disease in both men and women in Asia. [1] It is the second cause of cancer death in the last decade, CRC is classically divided into two categories: Hereditary and nonhereditary. [2],[3] Approximately 15% of CRC cases are considered as a hereditary form which contains: Polyposis and non-polyposis. [4],[5] Familial adenomatous polyposis (FAP) is a colon cancer predisposition syndrome that resulting of mutation in adenomatous polyposis coli (APC) gene. [6] The main feature of FAP is polypogenesis beginning in the early of adulthood mainly in 16-year-old (with average 7-36), polyps without early diagnosis and cure turn to colon cancer an average age of 39-year-old inevitably. [7] APC gene has 15 coding region that exon 15 is the largest exon of APC gene, which is the hot spot region in this gene. [8] About 60-70% of APC mutations are microdeletions and 10-15% are large deletion. [9],[10],[11] Large fragments deletion do not identify by traditional methods, therefore, the use of alternative technique in detection of any more alterations in this gene is necessary. [12] There are several methods to investigate large deletions such as fluorescent in situ hybridization, semiquantitative-polymerase chain reaction (PCR), Southern Blot and multiplex amplifiable probe hybridization but some studies suggested that multiplex ligation probe amplification (MLPA) has a higher throughput, more cheaper and very accurate technique to detection large deletion. [13],[14],[15],[16],[17] APC is the first gene that is mutated in patients with FAP and has a dominant inheritance pattern in this illness moreover; conversion of FAP to cancer is preventable. [18] The aim of the current study was to standardize of MLPA technique in detection of APC rearrangements for the 1 st time in IRAN to improve diagnostic protocol in order to set up more complete protocol for screening of the carriers.


 » Subjects and Methods Top


Patients

The studied samples consist of 34 FAP patients. They had been registered in our hospital during the years 2010-2012. The patients were selected in this study based on their colonoscopy results and all patients gave informed consent. Clinical data of patients including age of diagnosis, number of patients diagnosed with cancer, polyp type, polyp site and symptoms at diagnosis were recorded for the further investigation. All patients were screened for probably APC large deletions mutation. When, positive result was found, the given region was screened by PCR sequencing. All genetic alterations were confirmed in two separate rounds of MLPA. This study was conducted under the approval of the ethics committee of the gastroenterology and liver disease.

Deoxyribonucleic acid (DNA) extraction

DNA was obtained from peripheral blood were collected from the patients. Genomic DNA was extracted using saluting out standard method. [19]

MLPA

The MLPA analysis was performed on the APC gene using the probe mix PO43. The procedure conditions were conducted as recommended by the manufactures (MRC Holland, Amesterdam, The Netherlands). In brief, 250 ng of DNA was denatured during 5 min at 98°C and afterwards hybridized during 18 h at 60°C with the corresponding probes for each exon of each gene was analyzed. Subsequently, the hybridized products were incubated with a ligase for 15 min at 54°C and the ligation reaction was stopped with 5 min incubation at 98°C. Finally, the ligation products were amplified by PCR using a single set of FAM labeled primers and resolved by capillary electrophoresis on an ABI PRISM 3130 genetic analyzer. The obtained results were analyzed using the software Gene-Marker v1.6 (Soft Genetics, LLC.PA, USA).

PCR sequencing of the altered region in exon 15

To confirm the alteration detected by MLPA in two patients, two pairs primers were designed for PCR amplification 5′TGTCAGTAGTAGTGATGGTTATG3′ (Forward), 5′CAGATGAACTCTTTGAGAATG3′ (Reverse) for amplification region near probe number 03324-L02527 binding site and 5′TGAAGAAGAAGAGAGACCAAC3′ (Forward), 5′AAGTGAACTGACAGAAGTACATC3′ (Reverse) for amplification region near probe number 03325-L02528 binding site. The first primer PCR condition is initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 40 s at 52.3°C, 40 s at 72°C and a final 5 min extension at 72°C. And for the second primer PCR condition was carried out with the following condition: Initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 50 s at 57.6°C, 40 s at 72°C and a final 5 min extension at 72°C. A PCR reaction without DNA template was used as a negative control in each run. PCR was performed in a total volume of 25 ΅l of the reaction mixture containing 100 ng of genomic DNA of each sample, Χ10 PCR buffer 2.5 ΅l, MgCl2 2 mM, dNTP 0.2 mM and 1.25 U Super Taq polymerase, first pair primers 4.10 −7 mM and second pair primers 2.10 −7 mM were used. The amplified products were separated on 1% agarose gel in Tris boric acid containing ethidium boromaid and were photographed under ultraviolet light. Afterward 0.5 ΅l PCR product were submitted to the sequencing reaction using the BigDye Terminator V3.1 sequencing kit (Applied Biosystems). 25 cycles were amplified employing 0.5 ΅l of sense primer, with denaturing at 95°C for 30s annealing at 60°C for 15 s and extension at 60°C for 4 min. Sequences were analyzed using a sequencer (ABI 3130 XL Genetic analyzer).The electropherograms were analyzed using software DNA Lasergene version 6 (DNA STAR, Inc, Wisconsin USA). Statistical analysis was performed using the SPSS software program for Windows, Release 13.0.0 (SPSS Inc., Chicago, IL). Comparison of variables was performed using Pearson's Chi-square test, Fisher's exact test, or the Mann-Whitney U-test, depending on the nature of the data. Two-tailed P < 0.05 was considered statistically significant.


 » Results Top


All the patients had a clinical diagnosis of classic FAP according to diagnosis algorithm of FAP patients. MLPA results showed APC gene has large deletion in 2 patients. So the detection rate of large fragment deletions in APC was 5.8% (2 out of 34). Recognition of APC germline rearrangements led to detection deletions in two different sites of exon 15 of APC gene in 2 patients. In one patient a large fragment deletion was in the middle of exon 15 since in the other patient large fragment deletion was identified at the end of exon 15 (The kit was included 5 probes for exon 15). The peak on the similarity electropherogram was significantly reduced compared to the control sample [Figure 1] and the regression analysis showed an unexplained dot under the 0.73 limit [Figure 2], suggesting a deletion occurs on that region in one allele.
Figure 1: Multiplex ligation probe amplification electropherogram analyze. Patient with significant reduce in heights of probe number 03324-L02527 binding site in patient number 832766 (a) patient with significant reduce in heights of probe number 03325-L02528 binding site in patient number 832380 (b) and normal (c)

Click here to view
Figure 2: Regression analysis of patients. Dot under the 0.73 shows deletion in probe number 03324-L02527 binding site in patient number 832766 (a) dot under the 0.73 shows deletion in probe number 03325-L02528 in patient number 832380 (b) normal (c)

Click here to view


The clinical characteristic of the18 patients with and without deletion was compared [Table 1]. A total of 16 patients were characterized by the classical FAP phenotype but did not have deletions; the mean age of diagnosis of polyposis for them was 27.4-year-old and they had different symptoms at diagnosis consist of blood per rectum, anemia, weakness and weight loose, in some cases one person showed several signs. Polyp types were tubular adenoma, villus adenoma, tubule villus adenoma and carcinoma. In 2 patients with deletions, they had classical FAP phenotype; the mean age of diagnosis of polyposis for them was 35-year-old. The sing of their disease was blood per rectum in both cases and their polyp types were tubular adenoma and tubule villus adenoma. Statistical analyses did not show significant difference in clinical features including age at diagnosis, sign of disease and polyp type between patients with APC large deletion and patients without large deletion [Table 1].
Table 1: Comparison of the phenotypes of familial adenomatous polyposis between patients and families with and without identified APC mutations


Click here to view


Family history of patients

The first family, 832380, was classified as a classic FAP phenotype case; the proband was a 35-year-old male who referred to the hospital and clinically diagnosis as FAP. The proband's mother and his maternal uncle were diagnosed with CRC at age of 42 and 52, respectively and his brothers and sisters showed colorectal polyps at age 23, 21, 32, 27 and 25 [Figure 3]a. The second family, 832766, was detected as a classic FAP phenotype case; the proband was a 35-year-old man came to hospital and clinically diagnosis FAP. The proband's cousins and his brothers had FAP and the diagnosis of CRC event in his maternal uncle and his brother at age 35 and 49 respectively [Figure 3]b.
Figure 3: Pedigrees of the 2 familial adenomatous polyposis patients with large deletion. Family number 832380 (a) family number 832766 (b)

Click here to view


Confirmation of MLPA result

To explain the MLPA result was that there may be a missense mutation that had affected the hybridization of one of the MLPA probes for exon 15. Two pair primers were designed for exon 15, near the hybridization sites of both MLPA probes that show deletion in 2 patients and the PCR products of the index patient and a healthy control sample were sequenced. No point mutations were found in probe binding site.


 » Discussion Top


APC is an important tumor suppressor gene that is an important part of WNT signaling pathway when lose its normal activities it is the initiation stage to push the cell toward cancerous. This phenomenon occurs in both familial and sporadic colon cancer. Different types of mutations such as point mutations, small deletions or insertions and large deletion or insertions can occur in the APC gene. Large deletions are one of the important types of alteration in APC gene which lead to FAP. However, they cannot be identified by traditional techniques. Up to 80% mutations in APC gene that causing FAP are point mutations and a further 7-12% are large genomic deletions. [10],[20] Scanning of APC gene in 34 Iranian FAP patients led to find 2 different large deletions in two patients (5.8%). The detection rate of large deletions in Iranian population was close to Polish (5.6%), [21] Czech (6%), [22] Taiwanese (7.57%) [23] and Spanish (7.3%), [24] nevertheless, it was lower than Belgium (15%), [10] Swedish (12.5%) [12] and Chinese (14.2%). [25] Interestingly, in Greek and Slovak populations did not find any large deletion. [22],[26] Large deletions can occur in any site of APC such as individual 15 exons, promoter and 5′ untranslated region. In addition in some cases whole APC gene deletion can happen. In different populations deletions were determined in any fragment of APC gene, promoter (7 cases), exon 4 and exon 14 (4 cases) and whole gene deletion (15 cases) [Table 2]. In this study one patient had a large fragment deletion in the middle site of exon 15 and the second patient had deletion in the in the end of exon 15. Different studies from Chinese and Polish populations show deletions in the beginning or middle site of exon 15, but deletion in the end of exon 15 have not been reported [Table 2]. Since we didn't find any deleterious large deletions in exons 1-14, we suggested that exon 15 of APC gene is probably the hotspot region in Iranian FAP patients. The phenotypes difference in patients with gross mutation and patients without deletions were analyzed. Association of genotype/phenotype is well-known in FAP patients, but in this study statistical analyses did not show significant difference in each considerable factor such as age at diagnosis, sign of disease and polyp types between patients with and without large deletions. A few number of sample size may hinders the ability for strong statistical analysis. MUTYH account for 10-20% of classical FAP cases without an APC mutation and for 30% of attenuated familial adenomatous polyposis so screening of it is necessary to complete screening of patients. The cost effective, high throughput, high speed and simultaneously investigation MUTYH gene beside of APC gene is a huge benefit to choosing MLPA prior rather than after, point mutation analysis. It can increase number of carriers that screen for APC mutations and help to find them sooner in order to commence early cures.
Table 2: Comparison of the large deletions in APC gene in FAP patients from different populations


Click here to view



 » Acknowledgment Top


We acknowledge the co-operation of the FAP patients and their families and our colleagues.

 
 » References Top

1.
Sung JJ, Lau JY, Goh KL, Leung WK, Asia Pacific Working Group on Colorectal Cancer. Increasing incidence of colorectal cancer in Asia: Implications for screening. Lancet Oncol 2005;6:871-6.  Back to cited text no. 1
    
2.
Snover DC. Update on the serrated pathway to colorectal carcinoma. Hum Pathol 2011;42:1-10.  Back to cited text no. 2
[PUBMED]    
3.
Half E, Bercovich D, Rozen P. Familial adenomatous polyposis. Orphanet J Rare Dis 2009;4:22.  Back to cited text no. 3
    
4.
Bishop JM. The molecular genetics of cancer. Science 1987;235:305-11.  Back to cited text no. 4
[PUBMED]    
5.
Knudson AG Jr. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res 1985;45:1437-43.  Back to cited text no. 5
[PUBMED]    
6.
Galiatsatos P, Foulkes WD. Familial adenomatous polyposis. Am J Gastroenterol 2006;101:385-98.  Back to cited text no. 6
    
7.
Jasperson KW, Burt RW. Gene reviews™. In: Pagon RA, Adam MP, Bird TD, Dolan CR, Fong CT, Stephens K, editors. APC - Associated Polyposis Conditions. Seattle, WA: University of Washington; 1993-2013.  Back to cited text no. 7
    
8.
Vietri MT, Selvaggi F, De Paola ML, Sciaudone G, Guadagni I, Parisi M, et al. A novel frameshift mutation in exon 12 of the adenomatous polyposis coli gene in an Italian family with familial adenomatous polyposis and desmoid tumour. J Mol Genet Med 2010;4:235-8.  Back to cited text no. 8
    
9.
González S, Blanco I, Campos O, Julià M, Reyes J, Llompart A, et al. Founder mutation in familial adenomatous polyposis (FAP) in the Balearic Islands. Cancer Genet Cytogenet 2005;158:70-4.  Back to cited text no. 9
    
10.
Michils G, Tejpar S, Thoelen R, van Cutsem E, Vermeesch JR, Fryns JP, et al. Large deletions of the APC gene in 15% of mutation-negative patients with classical polyposis (FAP): A Belgian study. Hum Mutat 2005;25:125-34.  Back to cited text no. 10
    
11.
Nieuwenhuis MH, Vasen HF. Correlations between mutation site in APC and phenotype of familial adenomatous polyposis (FAP): A review of the literature. Crit Rev Oncol Hematol 2007;61:153-61.  Back to cited text no. 11
    
12.
Meuller J, Kanter-Smoler G, Nygren AO, Errami A, Grönberg H, Holmberg E, et al. Identification of genomic deletions of the APC gene in familial adenomatous polyposis by two independent quantitative techniques. Genet Test 2004;8:248-56.  Back to cited text no. 12
    
13.
Klinger K, Landes G, Shook D, Harvey R, Lopez L, Locke P, et al. Rapid detection of chromosome aneuploidies in uncultured amniocytes by using fluorescence in situ hybridization (FISH). Am J Hum Genet 1992;51:55-65.  Back to cited text no. 13
    
14.
Sellner LN, Taylor GR. MLPA and MAPH: New techniques for detection of gene deletions. Hum Mutat 2004;23:413-9.  Back to cited text no. 14
    
15.
Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 1975;98:503-17.  Back to cited text no. 15
[PUBMED]    
16.
Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 2002;30:e57.  Back to cited text no. 16
    
17.
Taylor CF, Charlton RS, Burn J, Sheridan E, Taylor GR. Genomic deletions in MSH2 or MLH1 are a frequent cause of hereditary non-polyposis colorectal cancer: Identification of novel and recurrent deletions by MLPA. Hum Mutat 2003;22:428-33.  Back to cited text no. 17
    
18.
Fearnhead NS, Britton MP, Bodmer WF. The ABC of APC. Hum Mol Genet 2001;10:721-33.  Back to cited text no. 18
    
19.
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.  Back to cited text no. 19
    
20.
Sieber OM, Lamlum H, Crabtree MD, Rowan AJ, Barclay E, Lipton L, et al. Whole-gene APC deletions cause classical familial adenomatous polyposis, but not attenuated polyposis or "multiple" colorectal adenomas. Proc Natl Acad Sci U S A 2002;99:2954-8.  Back to cited text no. 20
    
21.
Plawski A, Slomski R. APC gene mutations causing familial adenomatous polyposis in Polish patients. J Appl Genet 2008;49:407-14.  Back to cited text no. 21
    
22.
Stekrova J, Sulova M, Kebrdlova V, Zidkova K, Kotlas J, Ilencikova D, et al. Novel APC mutations in Czech and Slovak FAP families: Clinical and genetic aspects. BMC Med Genet 2007;8:16.  Back to cited text no. 22
    
23.
Chiang JM, Chen HW, Tang RP, Chen JS, Changchien CR, Hsieh PS, et al. Mutation analysis of the APC gene in Taiwanese FAP families: Low incidence of APC germline mutation in a distinct subgroup of FAP families. Fam Cancer 2010;9:117-24.  Back to cited text no. 23
    
24.
Gómez-Fernández N, Castellví-Bel S, Fernández-Rozadilla C, Balaguer F, Muñoz J, Madrigal I, et al. Molecular analysis of the APC and MUTYH genes in Galician and Catalonian FAP families: A different spectrum of mutations? BMC Med Genet 2009;10:57.  Back to cited text no. 24
    
25.
Sheng JQ, Cui WJ, Fu L, Jin P, Han Y, Li SJ, et al. APC gene mutations in Chinese familial adenomatous polyposis patients. World J Gastroenterol 2010;16:1522-6.  Back to cited text no. 25
    
26.
Fostira F, Thodi G, Sandaltzopoulos R, Fountzilas G, Yannoukakos D. Mutational spectrum of APC and genotype-phenotype correlations in Greek FAP patients. BMC Cancer 2010;10:389.  Back to cited text no. 26
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]

This article has been cited by
1 Clinical and Genetic Characterization of Familial Adenomatous Polyposis: An Iranian Population Study
Seyed Kazem Mirinezhad,Seyed Yaqoob Moaddab,Kourosh Masnadi Shirazi,Morteza Jabbarpour Bonyadi,Amir Taher Eftekharsadat,Sosan Mir Najead Grami,Mohammad Hossein Somi
Iranian Red Crescent Medical Journal. 2018; In Press(In Press)
[Pubmed] | [DOI]
2 Disruption of the APC gene by t(5;7) translocation in a Turcot family
Nora Sahnane,Barbara Bernasconi,Ileana Carnevali,Daniela Furlan,Alessandra Viel,Fausto Sessa,Maria Grazia Tibiletti
Cancer Genetics. 2016; 209(3): 107
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
 

    

  Site Map | What's new | Copyright and Disclaimer
  Online since 1st April '07
  © 2007 - Indian Journal of Cancer | Published by Wolters Kluwer - Medknow