Indian Journal of Cancer
Home  ICS  Feedback Subscribe Top cited articles Login 
Users Online :904
Small font sizeDefault font sizeIncrease font size
Navigate here
  Search
 
  
Resource links
 »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
 »  Article in PDF (1,545 KB)
 »  Citation Manager
 »  Access Statistics
 »  Reader Comments
 »  Email Alert *
 »  Add to My List *
* Registration required (free)  

 
  In this article
 »  Abstract
 » Introduction
 »  Materials and Me...
 » Results
 » Discussion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed1126    
    Printed22    
    Emailed0    
    PDF Downloaded189    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2014  |  Volume : 51  |  Issue : 4  |  Page : 524-529
 

Role of Sphk1 in the malignant transformation of breast epithelial cells and breast cancer progression


1 Breast Disease Center, Southwest Hospital, Third Military Medical University; Breast Disease Center, Chongqing Cancer Institute, Chongqing 400030, China
2 Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing, 400038, China

Date of Web Publication1-Feb-2016

Correspondence Address:
J Jiang
Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing, 400038
China
Y Zhang
Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing
China
Login to access the Email id

Source of Support: National Natural Science Foundation of China (No. 81072156), Science and Technology Application Development Project of Chongqing (No. cstc2013jcsf0143) and Project of Chongqing city health bureau (No. 2012.2.505)., Conflict of Interest: None


DOI: 10.4103/0019-509X.175343

Rights and Permissions

 » Abstract 

Background: The ojective of the following study is to investigate the role of sphingosine kinase 1 (Sphk1) in the malignant transformation of breast epithelial cells and breast cancer progression and its mechanism. Materials And Methods: Immunohistochemistry was performed to detect Sphk1 and E-cadherin (E-cad) in resected breast samples. Sphk1 was transfected in normal human breast epithelial cell line (MCF-10A) by Lentivirus and silenced in breast cancer cell line (MCF-7) using small interfering ribonucleic acid. The effect of tumor necrosis factor alpha (TNF-α) and/or N, N-dimethylsphingosine (DMS) on the Sphk1 and E-cad expression, MCF-10A cell proliferation and invasion was investigated. Real time-polymerase chain reaction and western-blot was used to detect messenger ribonucleic acid and protein. Cell counting kit-8 and transwell were used to measure cell proliferation and invasion. Results: Sphk1 was positive expression in 114 breast tumors (75.50%) but negative in fibroadenomas. The expression of E-cad and Sphk1 were negatively correlated and E-cad (−)/Sphk1 (+) carriers showed higher ratio of axillary lymph node metastasis than E-cad (+)/Sphk1 (−) carriers. Overexpression of Sphk1 in MCF-10A reduced E-cad expression and improved cell proliferation and invasion, but knockdown of Sphk1 in MCF-7 decreased cell proliferation and invasion. TNF-α increased Sphk1 expression, enhanced the ability of Sphk1 in decreasing E-cad expression, which could be blocked by DMS. TNF-α promoted MCF-10A cell proliferation and invasion. Conclusion: Sphk1 plays an important role in the malignant transformation of breast epithelial cells and modulates breast cancer metastasis through the regulation of E-cad expression. TNF-α can up-regulate Sphk1 expression and reduce E-cad expression through Sphk1, which can be blocked by DMS. TNF-α/Sphk1/E-cad pathway may be a newly discovered pathway and plays an important role in tumorigenesis and metastasis.


Keywords: Breast cancer, e-cadherin, malignant transformation, metastasis Sphingosine kinase 1


How to cite this article:
Zheng X D, Zhang Y, Qi X W, Wang M H, Sun P, Zhang Y, Jiang J. Role of Sphk1 in the malignant transformation of breast epithelial cells and breast cancer progression. Indian J Cancer 2014;51:524-9

How to cite this URL:
Zheng X D, Zhang Y, Qi X W, Wang M H, Sun P, Zhang Y, Jiang J. Role of Sphk1 in the malignant transformation of breast epithelial cells and breast cancer progression. Indian J Cancer [serial online] 2014 [cited 2019 Aug 22];51:524-9. Available from: http://www.indianjcancer.com/text.asp?2014/51/4/524/175343



 » Introduction Top


Breast cancer is the most common malignant tumor in women and distant metastasis is the major cause of tumor recurrence and death.[1] In the process of malignant transformation of normal cells to tumor cells, a series of cellular changes will occur, including morphological changes, loss of contact inhibition, excessive proliferation and migration ability, as well as enhanced expression of malignant genes.

The active metabolite of sphingomyelin, sphingosine-1-phosphate (S1P), can specifically bind to receptors located on the cell membrane to regulate cell proliferation, apoptosis, migration and adhesion molecule expressio.[2],[3] Sphingosine kinase (Sphk) is the rate-limiting enzyme of S1P synthesisand Sphk overexpression has been shown to reduce cell adhesion and promote cell migration.[3],[4] In 1998, the Sphk1 was first extracted from renal cells of rat and until present, two isomers (Sphk1 and Sphk2) have been found in human and mouse tissues. In human cells, the Sphk1 and Sphk2 genes are located on chromosome 17 and 19, respectively. They have different biological functions and regulation mechanisms. Sphk1 molecules mainly distribute in the brain, heart, lungs, liver, spleen and hematopoietic immune system and are related to the excessive proliferation of a variety of tumor cells. Sphk1 has been shown to play a dominant role in regulating S1P synthesis.[5]

Sphk1 regulates various biological processes, including cell proliferation, tumor metastasis and transformation.[6],[7],[8] Sphk1 overexpression has been detected in lung, thyroid, endometrial, prostate and gastric cancers.[9],[10],[11],[12] The mechanism of how tumor necrosis factor alpha (TNF-α) promotes tumor growth mechanism is not clear, but studies have found that TNF-α may promote cell proliferation and abnormal growth through a variety of ways: Inhibiting apoptosis and promoting cell proliferation with its receptor via multiple signaling pathways; regulating telomerase activity and translocation of human telomerase catalytic subunit from the cytoplasm to the nucleus by Nuclear Factor-KappaB p65 and promoting cell immortalization.[13] Guan H et al. found that Sphk1/S1P2 signaling pathway was a vital link of TNF-α in stimulating myogenesis.[14] Knapp P et al. showed that in 1321N1 glioblastoma cells, TNF-α activated Akt pathway and promoted cyclin D expression by up-regulating Sphk1 expression, thereby promoting cell proliferation.[15] However, only a few studies have reported the role Sphk1 plays in breast cancer development and metastasis. The exact role of Sphk1 in the progression of breast cancer and its mechanism remains unknown.

In our previous study on breast cancer, we found that no Sphk1 expressed in normal breast tissues and it increased gradually in atypical hyperplasia tissues. However, there was a strong expression of Sphk1 in breast cancer tissues. The results showed that Sphk1 might play an important role in the progression of breast cancer. In this study, the findings suggest that Sphk1 plays an important role in the malignant transformation of breast epithelial cells and modulates breast cancer metastasis through the regulation of E-cadherin (E-cad) expression. TNF-α/Sphk1/E-cad pathway may be a new pathway, which plays an important role in breast cancer occurrence and metastasis.


 » Materials and Methods Top


We obtained 171 surgical breast resection specimens from patients receiving breast cancer therapy in ## hospital between 2003 and 2006. Of these, 151 specimens were classified as invasive ductal carcinoma samples, in which the patients were females aged 29-76 (47.52 ± 10.01) years and all received modified radical mastectomy. Out of the 151 cases, 61 cases had no metastatic ipsilateral axillary lymph nodes and 90 cases had ≥ 1 metastatic ipsilateral axillary lymph nodes. The remaining 20 specimens were classified as fibroadenomas, in which patients were females aged 19-45 (23.48 ± 7.68) and did not undergo chemotherapy before mastectomy. All specimens were grouped and confirmed by pathology. The ethics committee of ## hospital approved the study and all patients formally declared their consent to be enrolled. Histopathological characteristics of tumor samples such as tumor size, location and differentiation grading were recorded. Furthermore, based on the Union International Cancer TNM (T: Tumor size; N: Lymph Node; M: Metastasis) classification guidelines, the surgical stages of the tumoral samples were defined.[16] The cell lines of MCF-10A and MCF-7 were obtained at ## Institute. Rabbit-anti-human Sphk1, rat-anti-human E-cad monoclonal antibodies and TNF-α were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

We used S-P immunohistochemical staining on both positive and negative controls (NCs) for each specimen. Cells that showed yellow-brown granules in the cytoplasm (Sphk1) or on membrane (E-cad) were determined positive staining.[17] We used the Bio-Mias Image Analytic Instrument to detect the integral optical density (IOD) of 5 five randomly selected images of each specimen (magnified 400 times) to quantify the intensity of immunohistochemical staining. Staining intensity was graded by the quartile of IOD value as 1 (1st quartile), 2 (2nd quartile), 3 (3rd quartile) and 4 (4th quartile) points and the positive cell ratio was graded as 1 (positive cell ≤ 25%), 2 (25%< positive cell ≤ 75%) and 3 (75%< positive cell ≤ 100%) points. The protein expression level was determined by the product of the grades for positive cell ratio and staining intensity and a score ≥ 4 was determined as positive immunohistochemical staining and distinguished the protein expression level from: "+" means 4-6, "++" means 7-9 and "+++" means 10-12. The estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER-2) status were assessed by referring to the American Society of Clinical Oncology/College of American Pathologists guideline.[18],[19]

The Sphk1 overexpression Lentivirus was constructed by cloning human Sphk1 cDNA into the LV-TOPO vector. This Lentivirus was transfected into MCF-10A cells to achieve overexpression of Sphk1 (MCF-10A-Sphk1) and utilized untransfected MCF-10A cells and MCF10A cells transfected with the empty vector plasmid as controls. In total 25 ng/ml, 50 ng/ml, 200 ng/ml, 300 ng/ml TNF-α and/or 0.5 µm/ml N, N-dimethylsphingosine (DMS) was added in MCF-10A cells group and MCF-10A-Sphk1 cells group. Then six groups were divided: MCF-10A group; MCF-10A + TNF-α group; MCF-10A + DMS + TNF-α group; MCF-10A-SPHK group; MCF-10A-SPHK + TNF-α group; MCF-10A-SPHK + DMS + TNF-α group. The cell proliferation at 0, 24, 48, 72 and 96 h were observed and the best analysis time point and concentration point were screened. The time point at 48 h after cells stimulation or inhibition was the best analysis time point and 50 ng/ml TNF-α was the best concentration point for cells stimulation. Then 50 ng/ml TNF-α was used to observe the effect on cells invasion, Sphk1 and E-cad expression. Fluorescent labeled Sphk1-targeting small interfering ribonucleic acid (siRNA) (sense strand: GUG CAC CCA AAC UAC UUC UTT, antisense strand: AGA AGU AGU UUG GGU GCA CTT) and NC siRNA (sense strand: UUC UCC GAA CGU GUC ACG UTT, antisense strand: ACG UGA CAC GUU CGG AGA ATT) were synthesized by ## company. The Sphk1 silencing experiment was performed using MCF7 cells (MCF-7-siRNA group) and MCF-7 cells transfected with the NC siRNA were used as controls (MCF-7-NC group). The transfection of the Lentivirus and siRNA were performed according to the instructions provided with the Lipofectamine 2000 reagent (##).

Total RNA extraction, reverse transcription and real time-polymerase chain reaction (RT-PCR) were performed according to the instruction provided by ##. The primer sequences (5'→3') for Sphk1, E-cad and β-actin were designed as:

  • Sphk1 up-stream: CAATGAAGACCTCCTGACCAA; down-stream: CAGACGCCGATACTTCTCACT
  • E-cad up-stream: CGCCTTATGATTCTCTGCTCGTG; down-stream: CTCGCCGCCTCCGTACATGTC
  • β-actin up-stream: ACCCCGTGCTGCTGACCGAG; down-stream: TCCCGGCCAGCCAGGTCCA.


PCR reaction was set as: Pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, elongation at 72°C for l min, for 30 cycles and final elongation at 72°C for 7 min.

Total protein was isolated from cell lysates and quantified using the Bradford method. 50 µg protein was run on a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidere fluoride (PVDF) membrane. The membrane was blocked in 5% skim-milk for 4 h at room temperature, incubated with rabbit-anti-Sphk1 primary antibody (1:1000 dilution) at 37°C for 4 h, washed with Phosphate Buffered Saline (PBS) and incubated with a goat anti-rabbit secondary antibody (1:2500 dilution) at 37°C for 2 h and were exposed and developed using an enhanced chemiluminescence reagent. The film was scanned for analysis.

Cell proliferation was measured according to the package instruction of the cell counting kit-8 ([CCK-8] reagent ##) on technical triplicates within each sample group. A Thermo Varioskan Flash Reader (##) was used to detect the optical density at a wavelength of 450 nm (D (450)). The cell growth curve was plotted with the detection time on the X-axis and the D (450) value on the Y-axis. Results of the CCK-8 assay were analyzed for statistical significance.

The polycarbonate membrane in the upper chamber of a 24-well transwell (##) was coated with 70 µl of matrigel (1 mg/ml, 37°C, 60 min) to form the basement membrane. Cells in each experimental group were diluted at a concentration of 1 cells/ml × 105 cells/ml. A volume of 200 µl of cell suspension and 800 µl 10% bovine serum albumin-containing Dulbecco's Modified Eagle Medium high glucose medium were added into the upper chamber of the transwell cell culture system. After 24 h incubation at 37°C, 5% CO2, cells were collected from the upper surface of the transwell membrane with a cotton swab, fixed with methanol and stained by crystal violet for 15 min. We randomly selected five sections to calculate the average number of cells collected at a × 100 using a light microscope.

Statistical analysis was performed using the software Statistical Package for the Social Sciences 17.0 (IBM). Measurement data is presented as mean ± SD. Counting data was examined by Chi-square test (row × column tables) and inter-group comparison was made by correspondence analysis. Significance was defined at P < 0.05.


 » Results Top


Sphk1 is mainly expressed in the cytoplasm. A total of 37, 15, 76 and 23 cases had – [Figure 1]a, + [Figure 1]b, ++ [Figure 1]c and +++ [Figure 1]d Sphk1 expression respectively. The overall positive Sphk1 expression ratio was 75.50% (114/151) in invasive ductal carcinoma samples and 0% (0/20) in fibroadenoma samples (P = 0.000) [Figure 1]e and [Table 1]. Analysis showed that Sphk1 expression was significantly associated with clinical T stage (P = 0.000), pN stage (P = 0.000), ER expression (P = 0.034) and HER-2 expression (P = 0.013) and had no correlation with age, menopausal status, or PR expression [Table 2].
Figure 1: Sphingosine kinase 1 (Sphk1) and E-cadherin (E-cad) expression in breast tissues. (a) Sphk1., (b) Sphk1+, (c) Sphk1++, (d) Sphk1+++, (e) Sphk1., (f) E-cad., (g) E-cad+, (h) E-cad++, (i) E-cad+++, (j) E-cad+, (a-d and f-i) for invasive ductal carcinoma, (e and j) for breast fibroadenoma

Click here to view
Table 1: Sphk1 expression in invasive ductal carcinoma and fibroadenoma of the breast

Click here to view
Table 2: Relationship between Sphk1 expression and the clinical-pathological features of breast ductal carcinoma

Click here to view


E-cad is mainly expressed on cell membrane. A total of 32, 35, 60 and 24 cases showed: [Figure 1]f, + [Figure 1]g, ++ [Figure 1]h and +++ [Figure 1]i E-cad expression, respectively. The overall E-cad positive expression ratio was 78.81% (119/151) in invasive ductal carcinoma samples and was 100% (20/20) in fibroadenoma samples [Figure 1]j. Analysis indicated that Sphk1 and E-cad expression were significantly associated and dimensional analysis showed that the first and second dimension respectively explained 76.3% and 23.7% of the total information and together explained all the information from the raw data. E-cad and Sphk1 expressions were determined to be negatively correlated by the Chi-square test [P = 1 × 10 13, [Table 3] and [Table 4]]. Two-dimensional factor analysis shows the low E-cad expression is linked with high Sphk1 expression and, conversely, high E-cad expression is linked with low Sphk1 expression [Figure 2].
Figure 2: Two-dimensional factor map of sphingosine kinase 1 and E-cadherin expression in invasive ductal carcinoma

Click here to view
Table 3: Distribution of Sphk1 and E-cad expression

Click here to view
Table 4: Correspondence analysis of Sphk1 and E-cad expression

Click here to view


Immunohistochemical staining showed that 71.88% (23/32) of samples with Sphk1 expression but not E-cad expression (E-cad [−]/Sphk1 [+]) also had lymph node metastasis, whereas 16.22% (6/37) of samples with E-cad expression, but not Sphk1 expression levels (E-cad [+]/Sphk1 [−]) had lymph node metastasis [Table 5]. The difference between these two groups was of statistical significance (P = 1.3592 × 10 − 10).
Table 5: Effects of Sphk1 and E-cad on lymph node metastasis

Click here to view


After transfection, Sphk1 messenger ribonucleic acid (mRNA) and protein levels in MCF10A-Sphk1 cells were confirmed to be significantly higher than that of the controls (MCF10A and MCF10A-empty plasmid cells) [Figure 3]a,[Figure 3]b,[Figure 3]c. Sphk1 overexpression significantly reduced the E-cad mRNA and protein levels [Figure 3]a and [Figure 3]b. The proliferative capacity of MCF10A-Sphk1 cells was also significantly higher than that of the controls [Figure 3]d. The cell invasion experiment showed that the number of migrated MCF10A-Sphk1 cells was 53 ± 5, which was significantly higher than that of the control cells [Figure 3]e and [Figure 3]f.
Figure 3: Effects of sphingosine kinase 1 (Sphk1) over-.expression in MCF-.10A. (a) Real time-.polymerase chain reaction detection of Sphk1 and E-.cadherin (E-.cad) expression; (b) western-.blot detection of Sphk1 and E-.cad expression; (c) immunohistochemical detection of Sphk1 expression; (d) effects on cell proliferation; (e and f) effects on cell invasion. (1) MCF-.10A; (2) MCF-.10A-.empty plasmid; (3) MCF-.10A-.Sphk1

Click here to view


Compared with 25 ng/ml, 200 ng/ml and 300 ng/ml TNF-α, 50 ng/ml TNF-α could better promote cell proliferation [Figure 4]a. 50 ng/ml TNF-α promoted MCF-10A-Sphk cell invasion and DMS blocked this effect [Figure 4]b and [Table 6]. TNF-α could up-regulate Sphk1 expression and down-regulate E-cad expression through Sphk1, but DMS blocked its regulation [Figure 4]c and [Figure 4]d.
Figure 4: Effects of TNF-α and N,N-dimethylsphingosine (DMS) on sphingosine kinase 1 and E-cadherin expression, MCF10A cell proliferation and invasion. (a) Real time-polymerase chain reaction, (b) western-blot, (c) cell proliferation, (d) cell invasion. (1) MCF-1, (2) MCF-10A + TNF-α; (3) MCF-10A+DMS + TNF-α; (4) MCF-10A-SPHK; (5) MCF-10A-SPHK + TNF-α; (6) MCF-10A-SPHK + DMS + TNF-α

Click here to view
Table 6: Effect of Sphk1 activator TNF-α (50 ng/ml) and inhibitor DMS on MCF-10A cell invasion

Click here to view


After transfection, siRNA effectively reduced Sphk1 expression in MCF-7 cells, as confirmed by RT-PCR and western-blot [Figure 5]a and [Figure 5]b. The proliferation capacity of the MCF-7-siRNA cells was significantly reduced when compared with MCF-7-NC cells [Figure 5]c. Migration of MCF-7 cells was also significantly suppressed after Sphk1 silencing [Figure 5]d and [Figure e].
Figure 5: Effects of silencing of sphingosine kinase 1 on MCF-7. (a) Real time-polymerase chain reaction, (b) western-blot, (c) cell proliferation, (d and e) effects on cell invasion in MCF-7 cells. (1) MCF-7-small interfering ribonucleic acid; (2) MCF-7-NC; (3) MCF-7

Click here to view



 » Discussion Top


Sphk1 overexpression has been previously shown to be significantly associated with colorectal cancer progression and transformation.[20] Our study detected no Sphk1 expression in breast fibroadenoma while 75.50% breast invasive ductal carcinoma samples showed increased Sphk1 expression, indicating that Sphk1 may be associated with the development of breast cancer. We also found that increased Sphk1 expression was closely related to breast tumor size, pN stage, ER negative expression and HER-2 positive expression. Overexpression of Sphk1 in MCF-10A cells significantly improved cell proliferation and invasion while silencing of Sphk1 in MCF-7 cells reduced cell proliferation and migration, indicating that Sphk1 may participate in the metastasis of breast cancer. Studies have reported that Sphk1 expression was significantly higher in head and neck squamous cell carcinoma when compared with normal tissues and inhibiting Sphk1 activity could increase the sensitivity of non-small cell lung cancer cells to chemotherapy-induced apoptosis.[21],[22] Sphk1 has also been shown to be highly expressed in non-Hodgkin's lymphoma (NHL) compared with reactive lymphoid hyperplasia, with the expression level increasing with clinical stages, indicating that Sphk1 may promote the development and progression of NHL as well.[23]

E-cad is a member of the metastasis-associated mucin family and is a key factor in regulating calcium-dependent cell-cell adhesion.[24] The extracellular domain of E-cad can bind to immunoglobin domains to maintain cell adhesion and cell polarity.[25] Loss or decreased expression of E-cad can be seen as an effective indicator in the prediction of gastric cancer progress and in the prognosis of lymph node metastasis.[26] Our findings showed that Sphk1 and E-cad expression were inversely related, showing that increased Sphk1 expression is linked to decreased E-cad expression and conversely, low Sphk1 is associated with high E-cad expression. In addition, we found that the ratio of lymph node metastasis in E-cad (−)/Sphk1 (+) patients was higher than E-cad (+)/Sphk1 (−) patients, indicating that simultaneous detection of Sphk1 and E-cad expression is of clinical significance for the diagnosis and prognosis of lymph node metastasis. It has now been recognized that epithelial-mesenchymal transition (EMT) plays a critical role in the metastasis of various cancers.[27] E-cad is an essential factor in maintaining cell adhesion. A critical step required for EMT is the decrease or loss of E-cad expression, which has been shown to play an important role in the in situ invasion and metastasis of breast cancer.[28],[29] Therefore, low expression of E-cad can be considered an indicator for tumor progression, lymph node metastasis and in prognosis evaluation. In our study, E-cad mRNA and protein levels were significantly reduced in MCF-10A cells when Sphk1 was overexpressed, indicating that Sphk1 may act as an upstream factor that negatively regulates E-cad expression, thus inducing EMT and lymph node metastasis during breast cancer progression. Our findings indicated that Sphk1 may promote breast cancer cell EMT and lymph node metastasis by negative regulation of E-cad expression.

The study by Donati, et al. found that Sphk1/S1P2 signaling pathway was a vital link of TNF-α in stimulating myogenesis.[14] A study done by Radeff-Huang, et al. showed that in 1321N1 glioblastoma cells, TNF-α activated Akt pathway and promoted cyclin D expression by up-regulating Sphk1 expression, thereby promoting cell proliferation.[15] Moreover, in our study, we found that TNF-α could up-regulate Sphk1 expression and down-regulate E-cad expression, but Sphk1 inhibitor DMS could block its down-regulation. This indicates that TNF-α/Sphk1/E-cad pathway plays an important role in breast cancer metastasis in, which may be a new pathway we find, but further studies are required to fully elucidate the underlying mechanisms.

Our findings suggest that Sphk1 plays an important role in the malignant transformation of breast epithelial cells and modulates breast cancer metastasis through the regulation of E-cad expression. TNF-α/Sphk1/E-cad pathway may be a new pathway, which plays an important role in breast cancer occurrence and metastasis. However, the further mechanism has yet to be elucidated.

 
 » References Top

1.
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin 2013;63:11-30.  Back to cited text no. 1
    
2.
Pappu R, Schwab SR, Cornelissen I, Pereira JP, Regard JB, Xu Y, et al. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science 2007;316:295-8.  Back to cited text no. 2
    
3.
Donati C, Nincheri P, Cencetti F, Rapizzi E, Farnararo M, Bruni P. Tumor necrosis factor-alpha exerts pro-myogenic action in C2C12 myoblasts via sphingosine kinase/S1P2 signaling. FEBS Lett 2007;581:4384-8.  Back to cited text no. 3
    
4.
Akiyama M, Hideshima T, Hayashi T, Tai YT, Mitsiades CS, Mitsiades N, et al. Nuclear factor-kappaB p65 mediates tumor necrosis factor alpha-induced nuclear translocation of telomerase reverse transcriptase protein. Cancer Res 2003;63:18-21.  Back to cited text no. 4
    
5.
Radeff-Huang J, Seasholtz TM, Chang JW, Smith JM, Walsh CT, Brown JH. Tumor necrosis factor-alpha-stimulated cell proliferation is mediated through sphingosine kinase-dependent Akt activation and cyclin D expression. J Biol Chem 2007;282:863-70.  Back to cited text no. 5
    
6.
Okada T, Kajimoto T, Jahangeer S, Nakamura S. Sphingosine kinase/sphingosine 1-phosphate signalling in central nervous system. Cell Signal 2009;21:7-13.  Back to cited text no. 6
    
7.
Ader I, Malavaud B, Cuvillier O. When the sphingosine kinase 1/sphingosine 1-phosphate pathway meets hypoxia signaling: New targets for cancer therapy. Cancer Res 2009;69:3723-6.  Back to cited text no. 7
    
8.
Marsolais D, Rosen H. Chemical modulators of sphingosine-1-phosphate receptors as barrier-oriented therapeutic molecules. Nat Rev Drug Discov 2009;8:297-307.  Back to cited text no. 8
    
9.
Shida D, Kitayama J, Yamaguchi H, Yamashita H, Mori K, Watanabe T, et al. Lysophospholipids transactivate HER2/neu (erbB-2) in human gastric cancer cells. Biochem Biophys Res Commun 2005;327:907-14.  Back to cited text no. 9
    
10.
Mu Z, Wang H, Zhang J, Li Q, Wang L, Guo X. KAI1/CD82 suppresses hepatocyte growth factor-induced migration of hepatoma cells via upregulation of Sprouty2. Sci China C Life Sci 2008;51:648-54.  Back to cited text no. 10
    
11.
Ruckhäberle E, Rody A, Engels K, Gaetje R, von Minckwitz G, Schiffmann S, et al. Microarray analysis of altered sphingolipid metabolism reveals prognostic significance of sphingosine kinase 1 in breast cancer. Breast Cancer Res Treat 2008;112:41-52.  Back to cited text no. 11
    
12.
Johnson KR, Johnson KY, Crellin HG, Ogretmen B, Boylan AM, Harley RA, et al. Immunohistochemical distribution of sphingosine kinase 1 in normal and tumor lung tissue. J Histochem Cytochem 2005;53:1159-66.  Back to cited text no. 12
    
13.
Guan H, Liu L, Cai J, Liu J, Ye C, Li M, et al. Sphingosine kinase 1 is overexpressed and promotes proliferation in human thyroid cancer. Mol Endocrinol 2011;25:1858-66.  Back to cited text no. 13
    
14.
Knapp P, Baranowski M, Knapp M, Zabielski P, Bachnio-Zabielska AU, Górski J. Altered sphingolipid metabolism in human endometrial cancer. Prostaglandins Other Lipid Mediat 2010;92:62-6.  Back to cited text no. 14
    
15.
Malavaud B, Pchejetski D, Mazerolles C, de Paiva GR, Calvet C, Doumerc N, et al. Sphingosine kinase-1 activity and expression in human prostate cancer resection specimens. Eur J Cancer 2010;46:3417-24.  Back to cited text no. 15
    
16.
Wittekind C, Oberschmid B. TNM classification of malignant tumors 2010: General aspects and amendments in the general section. Pathologe 2010;31:333-4, 336.  Back to cited text no. 16
    
17.
Ochiumi T, Tanaka S, Oka S, Hiyama T, Ito M, Kitadai Y, et al. Clinical significance of angiopoietin-2 expression at the deepest invasive tumor site of advanced colorectal carcinoma. Int J Oncol 2004;24:539-47.  Back to cited text no. 17
    
18.
Hammond EH, Hayes DF, Dowsett M, Allred DC, Hagerty KL, Badve S, et al. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for immunohistochemical testing of estrogenand progesterone receptorsin breast cancer. J Clin Oncol 2010;28:e48-72.  Back to cited text no. 18
    
19.
Wolff AC, Hammond ME, Hicks DG, Dowsett M, McShane LM, Allison KH, et al. Recommendations for human epidermal growth factor receptor 2 testing in breast cancer: American Society of Clinical Oncology/College of American Pathologists Clinical practice guideline update. J Clin Oncol 2013;31:3997-4013.  Back to cited text no. 19
    
20.
Kawamori T, Kaneshiro T, Okumura M, Maalouf S, Uflacker A, Bielawski J, et al. Role for sphingosine kinase 1 in colon carcinogenesis. FASEB J 2009;23:405-14.  Back to cited text no. 20
    
21.
Facchinetti MM, Gandini NA, Fermento ME, Sterin-Speziale NB, Ji Y, Patel V, et al. The expression of sphingosine kinase-1 in head and neck carcinoma. Cells Tissues Organs 2010;192:314-24.  Back to cited text no. 21
    
22.
Song L, Xiong H, Li J, Liao W, Wang L, Wu J, et al. Sphingosine kinase-1 enhances resistance to apoptosis through activation of PI3K/Akt/NF-kB pathway in human non-small cell lung cancer. Clin Cancer Res 2011;17:1839-49.  Back to cited text no. 22
    
23.
Bayerl MG, Bruggeman RD, Conroy EJ, Hengst JA, King TS, Jimenez M, et al. Sphingosine kinase 1 protein and mRNA are overexpressed in non-Hodgkin lymphomas and are attractive targets for novel pharmacological interventions. Leuk Lymphoma 2008;49:948-54.  Back to cited text no. 23
    
24.
Takeichi M. Cadherin cell adhesion receptors as a morphogenetic regulator. Science 1991;251:1451-5.  Back to cited text no. 24
    
25.
Schmalhofer O, Brabletz S, Brabletz T. E-cadherin, beta-catenin, and ZEB1 in malignant progression of cancer. Cancer Metastasis Rev 2009;28:151-66.  Back to cited text no. 25
    
26.
Saad AA, Awed NM, Abd Elkerim NN, El-Shennawy D, Alfons MA, Elserafy ME, et al. Prognostic significance of E-cadherin expression and peripheral blood micrometastasis in gastric carcinoma patients. Ann Surg Oncol 2010;17:3059-67.  Back to cited text no. 26
    
27.
Guarino M. Epithelial-mesenchymal transition and tumour invasion. Int J Biochem Cell Biol 2007;39:2153-60.  Back to cited text no. 27
    
28.
Wells A, Yates C, Shepard CR. E-cadherin as an indicator of mesenchymal to epithelial reverting transitions during the metastatic seeding of disseminated carcinomas. Clin Exp Metastasis 2008;25:621-8.  Back to cited text no. 28
    
29.
Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 2004;117:927-39.  Back to cited text no. 29
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6]



 

Top
Print this article  Email this article
 

    

  Site Map | What's new | Copyright and Disclaimer
  Online since 1st April '07
  © 2007 - Indian Journal of Cancer | Published by Wolters Kluwer - Medknow